Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14123
Trapped Gene
Defb29 (ENSMUSG00000044249)
Vector Insertion
Chr 2: 152364757 - 152365679
Public Clones CMHD-GT_115H7-3 (cmhd) CMHD-GT_400A3-3 (cmhd) CMHD-GT_70.1H9-3 (cmhd) CMHD-GT_70A4-3 (cmhd)
Private Clones OST19769 (lexicon) OST8050 (lexicon)
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000364916 (Chr2:152365680..152365777 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCCTGGTTGACGAGACCAC Chr2:152365682..152365701 59.97 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000364916 (Chr2:152365680..152365777 -)
Downstram Exon
ENSMUSE00000411009 (Chr2:152364450..152364756 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCCTGGTTGACGAGACCAC Chr2:152365682..152365701 59.97 55 CCTCTTGCTACTGCGGAATC Chr2:152364703..152364722 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000364916 Chr2:152365680..152365777 ATCCTGGTTGACGAGACCAC Chr2:152365682..152365701 59.97 55

*** Putative Vector Insertion (Chr 2: 152364757 - 152365679) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000411009 Chr2:152364450..152364756 CCTCTTGCTACTGCGGAATC Chr2:152364703..152364722 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000044249