Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14132
Trapped Gene
Stmn2 (ENSMUSG00000027500)
Vector Insertion
Chr 3: 8545746 - 8554791
Public Clones CMHD-GT_110A8-3 (cmhd)
Private Clones OST336540 (lexicon) OST178346 (lexicon)
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000170117 (Chr3:8545573..8545745 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATGGAGGTGAAGCAGATCA Chr3:8545574..8545593 59.79 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000170117 (Chr3:8545573..8545745 +)
Downstram Exon
ENSMUSE00000569583 (Chr3:8554792..8554983 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATGGAGGTGAAGCAGATCA Chr3:8545574..8545593 59.79 50 TTTCCTGCAGACGTTCAATG Chr3:8554984..8555003 59.84 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000382200 Chr3:8509521..8509630 ACAGCTGGACCCTTCTCCTT Chr3:8509555..8509574 60.25 55
upstream ENSMUSE00000705955 Chr3:8509565..8509630 No primer for this exon
upstream ENSMUSE00000311839 Chr3:8541841..8541936 CGCGCAACATCAACATCTAC Chr3:8541907..8541926 60.29 50
upstream ENSMUSE00000170117 Chr3:8545573..8545745 CATGGAGGTGAAGCAGATCA Chr3:8545574..8545593 59.79 50

*** Putative Vector Insertion (Chr 3: 8545746 - 8554791) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000569583 Chr3:8554792..8554983 TTTCCTGCAGACGTTCAATG Chr3:8554984..8555003 59.84 45
downstream ENSMUSE00000170122 Chr3:8560266..8561604 TAATGCAGCAACCAGCTCAC Chr3:8561280..8561299 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr3:8548794..8548814 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGACCTCGGCTTTGAGTT Chr3:8548735..8548755 60.25 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027500