Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14138
Trapped Gene
Itgae (ENSMUSG00000005947)
Vector Insertion
Chr 11: 72959154 - 72960552
Public Clones CMHD-GT_434D7-3 (cmhd) CMHD-GT_405B2-3 (cmhd) CMHD-GT_107A12-3 (cmhd) IST13048H9 (tigm)
Private Clones OST189671 (lexicon) OST149209 (lexicon) OST142367 (lexicon) OST62170 (lexicon)
OST62025 (lexicon) OST58940 (lexicon) OST56575 (lexicon) OST50154 (lexicon)
OST36567 (lexicon) OST25619 (lexicon) OST17412 (lexicon) OST12463 (lexicon)
OST12407 (lexicon) OST5420 (lexicon) OST2398 (lexicon) OST1142 (lexicon)
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000109196 (Chr11:72959043..72959153 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000109196 (Chr11:72959043..72959153 +)
Downstram Exon
ENSMUSE00000393547 (Chr11:72960553..72960943 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000578528 Chr11:72904085..72904156 No primer for this exon
upstream ENSMUSE00000109187 Chr11:72917363..72917486 No primer for this exon
upstream ENSMUSE00000109174 Chr11:72924008..72924105 No primer for this exon
upstream ENSMUSE00000109195 Chr11:72924833..72924900 No primer for this exon
upstream ENSMUSE00000109172 Chr11:72925248..72925365 No primer for this exon
upstream ENSMUSE00000109200 Chr11:72925559..72925690 No primer for this exon
upstream ENSMUSE00000109198 Chr11:72926456..72926571 No primer for this exon
upstream ENSMUSE00000109199 Chr11:72927084..72927235 No primer for this exon
upstream ENSMUSE00000109177 Chr11:72928359..72928512 No primer for this exon
upstream ENSMUSE00000109176 Chr11:72929009..72929159 No primer for this exon
upstream ENSMUSE00000109192 Chr11:72929582..72929649 No primer for this exon
upstream ENSMUSE00000109194 Chr11:72930616..72930754 No primer for this exon
upstream ENSMUSE00000310701 Chr11:72931554..72931699 No primer for this exon
upstream ENSMUSE00000109191 Chr11:72931997..72932137 No primer for this exon
upstream ENSMUSE00000109188 Chr11:72932832..72933056 No primer for this exon
upstream ENSMUSE00000109189 Chr11:72933777..72933907 No primer for this exon
upstream ENSMUSE00000109208 Chr11:72935346..72935476 No primer for this exon
upstream ENSMUSE00000109204 Chr11:72936610..72936770 No primer for this exon
upstream ENSMUSE00000109169 Chr11:72938761..72938889 No primer for this exon
upstream ENSMUSE00000310663 Chr11:72940381..72940454 No primer for this exon
upstream ENSMUSE00000310656 Chr11:72942671..72942803 No primer for this exon
upstream ENSMUSE00000109209 Chr11:72944425..72944523 No primer for this exon
upstream ENSMUSE00000109201 Chr11:72945190..72945269 No primer for this exon
upstream ENSMUSE00000109205 Chr11:72946196..72946270 No primer for this exon
upstream ENSMUSE00000109166 Chr11:72947345..72947408 No primer for this exon
upstream ENSMUSE00000109190 Chr11:72947493..72947600 No primer for this exon
upstream ENSMUSE00000661863 Chr11:72947493..72947663 No primer for this exon
upstream ENSMUSE00000109203 Chr11:72951957..72952013 No primer for this exon
upstream ENSMUSE00000109197 Chr11:72952269..72952364 No primer for this exon
upstream ENSMUSE00000109167 Chr11:72954169..72954264 No primer for this exon
upstream ENSMUSE00000109196 Chr11:72959043..72959153 No primer for this exon

*** Putative Vector Insertion (Chr 11: 72959154 - 72960552) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000393547 Chr11:72960553..72960943 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCATTTTGTTCAAGGTCAG Chr11:72959140..72959160 58.2 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005947