Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14145
Trapped Gene
S100a1 (ENSMUSG00000044080)
Vector Insertion
Chr 3: 90314958 - 90315287
Public Clones CMHD-GT_117B3-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 82% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672788 (Chr3:90314960..90315286 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACAAGAGTGGCAGTCCAGA Chr3:90314996..90315015 60.02 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672788 (Chr3:90314960..90315286 -)
Downstram Exon
ENSMUSE00000373524 (Chr3:90314959..90315286 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACAAGAGTGGCAGTCCAGA Chr3:90314996..90315015 60.02 55 TCTGGACTGCCACTCTTGTG Chr3:90314974..90314993 60.02 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000380803 Chr3:90318123..90318186 GCCCTTCTGTCGAGAATCTG Chr3:90318148..90318167 59.95 55
upstream ENSMUSE00000672787 Chr3:90318123..90318200 GCCCTTCTGTCGAGAATCTG Chr3:90318148..90318167 59.95 55
upstream ENSMUSE00000333133 Chr3:90315918..90316071 CCATGGAGACCCTCATCAAT Chr3:90316017..90316036 59.74 50
upstream ENSMUSE00000672786 Chr3:90315901..90316071 CCATGGAGACCCTCATCAAT Chr3:90316017..90316036 59.74 50
upstream ENSMUSE00000672790 Chr3:90315189..90315277 CTGGATGAAAACGGAGATGG Chr3:90315225..90315244 60.45 50
upstream ENSMUSE00000672788 Chr3:90314960..90315286 CACAAGAGTGGCAGTCCAGA Chr3:90314996..90315015 60.02 55
upstream ENSMUSE00000373524 Chr3:90314959..90315286 CACAAGAGTGGCAGTCCAGA Chr3:90314996..90315015 60.02 55

*** Putative Vector Insertion (Chr 3: 90314958 - 90315287) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000672789 Chr3:90314815..90314869 TTCGGACCCCTACATTTCTG Chr3:90314801..90314820 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCCCCTTCTACAGGTCCA Chr3:90315280..90315300 59.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATCCCCTTCTACAGGTCCA Chr3:90315280..90315300 59.92 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044080