Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14152
Trapped Gene
2010204K13Rik (ENSMUSG00000063018)
Vector Insertion
Chr X: 6989659 - 7000004
Public Clones (sanger) (ggtc) CMHD-GT_416H10-3 (cmhd) CMHD-GT_455C1-3 (cmhd) CMHD-GT_386G10-3 (cmhd)
CMHD-GT_458G4-3 (cmhd) CMHD-GT_394B4-3 (cmhd) CMHD-GT_366F7-3 (cmhd) CMHD-GT_458B4-3 (cmhd)
CMHD-GT_391D9-3 (cmhd) CMHD-GT_118B6-3 (cmhd) CMHD-GT_362H1-3 (cmhd) PSTVUpb16h8 (vanderbilt)
C26 (vanderbilt)
Private Clones OST273919 (lexicon) OST270061 (lexicon) OST257471 (lexicon) OST237338 (lexicon)
OST105611 (lexicon) OST57604 (lexicon) OST3335 (lexicon) OST270 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000707430 (ChrX:7000005..7000074 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTAGTGGGCCGGATGATTT ChrX:7000033..7000052 61.19 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000707430 (ChrX:7000005..7000074 -)
Downstram Exon
ENSMUSE00000304965 (ChrX:6989232..6989658 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTAGTGGGCCGGATGATTT ChrX:7000033..7000052 61.19 50 GAAAGGTCAGAGGGGGAAAG ChrX:6989277..6989296 60.04 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000707430 ChrX:7000005..7000074 CTTAGTGGGCCGGATGATTT ChrX:7000033..7000052 61.19 50

*** Putative Vector Insertion (Chr X: 6989659 - 7000004) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000304965 ChrX:6989232..6989658 GAAAGGTCAGAGGGGGAAAG ChrX:6989277..6989296 60.04 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCAGTTCCTGTTTGCTTAGG ChrX:6996989..6997010 59.36 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTAGACCGTGACTGGGAAAA ChrX:6996939..6996960 59.72 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGGATTAATCGCCTTGCAG ChrX:6997010..6997030 60.73 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCTTCGTGACTGGGAAAACC ChrX:6997008..6997028 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063018