Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14153
Trapped Gene
Zmat5 (ENSMUSG00000009076)
Vector Insertion
Chr 11: 4632182 - 4637334
Public Clones CMHD-GT_471H11-3 (cmhd) CMHD-GT_417F1-3 (cmhd) CMHD-GT_488F9-3 (cmhd) CMHD-GT_118B3-3 (cmhd)
IST11943H2 (tigm) IST12030C12 (tigm) IST11654H3 (tigm)
Private Clones OST395022 (lexicon) OST22909 (lexicon) OST14877 (lexicon) OST10949 (lexicon)
OST7978 (lexicon)
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000104279 (Chr11:4632070..4632181 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000104279 (Chr11:4632070..4632181 +)
Downstram Exon
ENSMUSE00000442230 (Chr11:4637335..4637535 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000104283 Chr11:4604688..4604724 No primer for this exon
upstream ENSMUSE00000104287 Chr11:4622361..4622514 No primer for this exon
upstream ENSMUSE00000104281 Chr11:4628588..4628650 No primer for this exon
upstream ENSMUSE00000104286 Chr11:4630190..4630270 No primer for this exon
upstream ENSMUSE00000104279 Chr11:4632070..4632181 No primer for this exon

*** Putative Vector Insertion (Chr 11: 4632182 - 4637334) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000442230 Chr11:4637335..4637535 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGACTCCTTAATCGCCTTG Chr11:4632224..4632244 60.95 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTCCTCGTGACTGGGAAAA Chr11:4632227..4632247 59.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000009076