Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14175
Trapped Gene
Mettl8 (ENSMUSG00000041975)
Vector Insertion
Chr 2: 70856276 - 70856432
Public Clones CMHD-GT_47H1-3 (cmhd) CMHD-GT_465H12-3 (cmhd)
Private Clones OST459770 (lexicon) OST453935 (lexicon) OST430369 (lexicon) OST421265 (lexicon)
OST415161 (lexicon) OST404086 (lexicon) OST391168 (lexicon) OST383403 (lexicon)
OST322983 (lexicon) OST322686 (lexicon) OST314802 (lexicon) OST303516 (lexicon)
OST303248 (lexicon) OST284847 (lexicon) OST269290 (lexicon) OST262077 (lexicon)
OST260930 (lexicon) OST235354 (lexicon) OST196862 (lexicon) OST170062 (lexicon)
OST115989 (lexicon) OST78153 (lexicon) OST77112 (lexicon) OST54914 (lexicon)
OST41437 (lexicon) OST33919 (lexicon) OST33896 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000721885 (Chr2:70856277..70856431 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTGGGGTCGAGGATTTTA Chr2:70856312..70856331 59.12 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000721885 (Chr2:70856277..70856431 -)
Downstram Exon
ENSMUSE00000719871 (Chr2:70856277..70856431 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTGGGGTCGAGGATTTTA Chr2:70856312..70856331 59.12 50 AGTCGGCAAATGCAACTTCT Chr2:70856363..70856382 59.88 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000601827 Chr2:70893428..70893584 GTGTCGCTTCACCTGTGTGT Chr2:70893546..70893565 59.79 55
upstream ENSMUSE00000601832 Chr2:70893428..70893640 CACGCGGTAAACCTGGATAG Chr2:70893596..70893615 60.51 55
upstream ENSMUSE00000690718 Chr2:70889729..70889790 No primer for this exon
upstream ENSMUSE00000718165 Chr2:70856277..70856431 CTCTGGGGTCGAGGATTTTA Chr2:70856312..70856331 59.12 50
upstream ENSMUSE00000719871 Chr2:70856277..70856431 CTCTGGGGTCGAGGATTTTA Chr2:70856312..70856331 59.12 50
upstream ENSMUSE00000721885 Chr2:70856277..70856431 CTCTGGGGTCGAGGATTTTA Chr2:70856312..70856331 59.12 50

*** Putative Vector Insertion (Chr 2: 70856276 - 70856432) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000644624 Chr2:70831541..70831632 CTTGCTCTTCTGGAGCGACT Chr2:70831519..70831538 59.89 55
downstream ENSMUSE00000644627 Chr2:70831541..70831632 CTTGCTCTTCTGGAGCGACT Chr2:70831519..70831538 59.89 55
downstream ENSMUSE00000321262 Chr2:70819912..70820252 TACCAGGAAACGGCTCTGTC Chr2:70819916..70819935 60.26 55
downstream ENSMUSE00000450557 Chr2:70819912..70820024 TACCAGGAAACGGCTCTGTC Chr2:70819916..70819935 60.26 55
downstream ENSMUSE00000321284 Chr2:70818434..70818483 TGTTCAGGATTGGAAACACG Chr2:70818419..70818438 59.54 45
downstream ENSMUSE00000450552 Chr2:70818117..70818210 CCATGTCTGACGCTAAGCAA Chr2:70818109..70818128 60.01 50
downstream ENSMUSE00000321276 Chr2:70814131..70814194 AGGCAAAGTCGCAGCAGTAG Chr2:70814132..70814151 60.73 55
downstream ENSMUSE00000644621 Chr2:70814131..70814194 AGGCAAAGTCGCAGCAGTAG Chr2:70814132..70814151 60.73 55
downstream ENSMUSE00000321327 Chr2:70811310..70811449 GTAGGCTAAGCCGTCGTCAC Chr2:70811356..70811375 59.9 60
downstream ENSMUSE00000690694 Chr2:70811310..70811449 GTAGGCTAAGCCGTCGTCAC Chr2:70811356..70811375 59.9 60
downstream ENSMUSE00000402297 Chr2:70810265..70810390 TGGGGGCTGTGACATCTTAT Chr2:70810308..70810327 60.34 50
downstream ENSMUSE00000483608 Chr2:70805107..70805213 TTCCATGATCCCGAAACAAT Chr2:70805118..70805137 60.13 40
downstream ENSMUSE00000690700 Chr2:70805107..70805213 TTCCATGATCCCGAAACAAT Chr2:70805118..70805137 60.13 40
downstream ENSMUSE00000484375 Chr2:70804530..70804570 No primer for this exon
downstream ENSMUSE00000644626 Chr2:70804505..70804528 No primer for this exon
downstream ENSMUSE00000690698 Chr2:70804505..70804570 No primer for this exon
downstream ENSMUSE00000690713 Chr2:70804505..70804570 No primer for this exon
downstream ENSMUSE00000718271 Chr2:70804505..70804570 No primer for this exon
downstream ENSMUSE00000715980 Chr2:70803494..70803736 AATCCACACTCGGTGCATCT Chr2:70803602..70803621 60.54 50
downstream ENSMUSE00000566495 Chr2:70802855..70803736 CTGAGTTCCCCCAAGAACAA Chr2:70803134..70803153 60.08 50
downstream ENSMUSE00000690688 Chr2:70802622..70803736 CTGAGTTCCCCCAAGAACAA Chr2:70803134..70803153 60.08 50
downstream ENSMUSE00000690703 Chr2:70802622..70803736 CTGAGTTCCCCCAAGAACAA Chr2:70803134..70803153 60.08 50
downstream ENSMUSE00000690708 Chr2:70802622..70803736 CTGAGTTCCCCCAAGAACAA Chr2:70803134..70803153 60.08 50
downstream ENSMUSE00000690712 Chr2:70802618..70803736 CTGAGTTCCCCCAAGAACAA Chr2:70803134..70803153 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGTTTGTGACTTTGCAGGT Chr2:70856428..70856449 60.35 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041975