Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14180
Trapped Gene
CT025653.7-201 (ENSMUSG00000047412)
Vector Insertion
Chr 9: 30838544 - 30860824
Public Clones (sanger) (sanger) 5SE288C03 (ggtc) 3SD048A06 (ggtc) 5SP143G04 (ggtc)
(ggtc) 3SD074B04 (ggtc) 3SE288C03 (ggtc) 5SE069D03 (ggtc) 3SP143G04 (ggtc)
(ggtc) 5SD048A06 (ggtc) 3SP143G09 (ggtc) 5SD074B04 (ggtc) CMHD-GT_45A1-3 (cmhd)
CMHD-GT_534A7-5S (cmhd) IST11089F6 (tigm) IST14976D3 (tigm) IST11451G12 (tigm)
IST14643G12 (tigm) IST14504F6 (tigm) IST14663E3 (tigm) IST14538A8 (tigm)
IST13643B2 (tigm)
Private Clones OST123255 (lexicon) OST123189 (lexicon) OST43465 (lexicon) OST43381 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000702098 (Chr9:30838229..30838543 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGAGGAGGAGCAGTTGCAG Chr9:30838494..30838513 59.74 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000702098 (Chr9:30838229..30838543 +)
Downstram Exon
ENSMUSE00000424081 (Chr9:30860825..30861898 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGAGGAGGAGCAGTTGCAG Chr9:30838494..30838513 59.74 55 GGGAACTTGTTTGGGTGCTA Chr9:30861496..30861515 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702098 Chr9:30838229..30838543 AAGAGGAGGAGCAGTTGCAG Chr9:30838494..30838513 59.74 55

*** Putative Vector Insertion (Chr 9: 30838544 - 30860824) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000424081 Chr9:30860825..30861898 GGGAACTTGTTTGGGTGCTA Chr9:30861496..30861515 59.97 50
downstream ENSMUSE00000450794 Chr9:30869626..30869710 TGGTGCTAGAGGTGCTCTGA Chr9:30869688..30869707 59.73 55
downstream ENSMUSE00000413910 Chr9:30871764..30871927 TTGGACACTGAAACGGTCTG Chr9:30871870..30871889 59.72 50
downstream ENSMUSE00000702097 Chr9:30871818..30871927 TTGGACACTGAAACGGTCTG Chr9:30871870..30871889 59.72 50
downstream ENSMUSE00000702093 Chr9:30874244..30874327 TTTAGCGAGTAAGCCCTGGT Chr9:30874307..30874326 59 50
downstream ENSMUSE00000363120 Chr9:30874339..30874544 TACTCCCCGAAGGAAGTGAA Chr9:30874388..30874407 59.67 50
downstream ENSMUSE00000702088 Chr9:30874753..30874760 No primer for this exon
downstream ENSMUSE00000638059 Chr9:30876330..30877844 GGGGAAAAGTGCTTTCACAA Chr9:30876487..30876506 60.09 45
downstream ENSMUSE00000702091 Chr9:30876330..30877844 GGGGAAAAGTGCTTTCACAA Chr9:30876487..30876506 60.09 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAGAACAACCACCTCCACTC Chr9:30841574..30841595 60.14 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGAACAACCACCTCCACTC Chr9:30841574..30841595 60.14 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047412