Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14188
Trapped Gene
Pik3ip1 (ENSMUSG00000034614)
Vector Insertion
Chr 11: 3232232 - 3233211
Public Clones CMHD-GT_1A8-3 (cmhd)
Private Clones OST388801 (lexicon)
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000314300 (Chr11:3232112..3232231 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCACAACTACTGCCGGAAC Chr11:3232121..3232140 60.03 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000314300 (Chr11:3232112..3232231 +)
Downstram Exon
ENSMUSE00000314294 (Chr11:3233212..3233415 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCACAACTACTGCCGGAAC Chr11:3232121..3232140 60.03 55 ACCTGTGCCTCTTTGTCACC Chr11:3233299..3233318 60.16 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000314311 Chr11:3230793..3231007 TGGACACTGGCTGTTGAGTC Chr11:3230895..3230914 59.87 55
upstream ENSMUSE00000595383 Chr11:3230811..3231007 TGGACACTGGCTGTTGAGTC Chr11:3230895..3230914 59.87 55
upstream ENSMUSE00000314307 Chr11:3231918..3232034 ACCTGTACCGGGAGGACCAG Chr11:3231939..3231958 63.56 65
upstream ENSMUSE00000314300 Chr11:3232112..3232231 ACCACAACTACTGCCGGAAC Chr11:3232121..3232140 60.03 55

*** Putative Vector Insertion (Chr 11: 3232232 - 3233211) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000314294 Chr11:3233212..3233415 ACCTGTGCCTCTTTGTCACC Chr11:3233299..3233318 60.16 55
downstream ENSMUSE00000314288 Chr11:3233508..3233586 AGCTCCAATAGCGAGGATGA Chr11:3233560..3233579 59.94 50
downstream ENSMUSE00000682486 Chr11:3233508..3233967 AGACGCCAAGAAGCTGATGT Chr11:3233671..3233690 60.02 50
downstream ENSMUSE00000314282 Chr11:3241526..3242973 TCCTTCAGGTCTTTCGCAGT Chr11:3242663..3242682 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr11:3232283..3232303 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACGTGAGTTGCCCAGGTACT Chr11:3232217..3232238 61.51 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034614