Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14189
Trapped Gene
Wdr1 (ENSMUSG00000005103)
Vector Insertion
Chr 5: 38952441 - 38952754
Public Clones CMHD-GT_25E8-5 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000382362 (Chr5:38952755..38952941 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000382362 (Chr5:38952755..38952941 -)
Downstram Exon
ENSMUSE00000282657 (Chr5:38952319..38952440 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000382362 Chr5:38952755..38952941 No primer for this exon

*** Putative Vector Insertion (Chr 5: 38952441 - 38952754) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000282657 Chr5:38952319..38952440 No primer for this exon
downstream ENSMUSE00000185894 Chr5:38942616..38942706 No primer for this exon
downstream ENSMUSE00000185900 Chr5:38938183..38938330 No primer for this exon
downstream ENSMUSE00000185893 Chr5:38936913..38937093 No primer for this exon
downstream ENSMUSE00000185891 Chr5:38932040..38932117 No primer for this exon
downstream ENSMUSE00000185899 Chr5:38931743..38931823 No primer for this exon
downstream ENSMUSE00000185903 Chr5:38931252..38931485 No primer for this exon
downstream ENSMUSE00000185896 Chr5:38928378..38928465 No primer for this exon
downstream ENSMUSE00000185902 Chr5:38926423..38926564 No primer for this exon
downstream ENSMUSE00000185892 Chr5:38924723..38924810 No primer for this exon
downstream ENSMUSE00000185898 Chr5:38922254..38922364 No primer for this exon
downstream ENSMUSE00000185895 Chr5:38921176..38921349 No primer for this exon
downstream ENSMUSE00000333063 Chr5:38920764..38920908 No primer for this exon
downstream ENSMUSE00000282584 Chr5:38918192..38919151 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAACAAGTGGGCGAGGATG Chr5:38952766..38952786 60.52 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTAACAAGTGGGCGAGGATG Chr5:38952766..38952786 60.52 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005103