Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14190
Trapped Gene
Snrpd2 (ENSMUSG00000040824)
Vector Insertion
Chr 7: 19736747 - 19737824
Public Clones P098E10 (ggtc) CMHD-GT_24B8-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000518660 (Chr7:19736567..19736746 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAGTCGGTCAAGAACAACA Chr7:19736663..19736682 59.88 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000518660 (Chr7:19736567..19736746 +)
Downstram Exon
ENSMUSE00000235315 (Chr7:19737825..19738075 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAGTCGGTCAAGAACAACA Chr7:19736663..19736682 59.88 50 TCTTGGGAACCTCAGTCCAC Chr7:19737883..19737902 60.09 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000235330 Chr7:19735187..19735243 GATCTGCGAGCGAAACCTAC Chr7:19735219..19735238 59.99 55
upstream ENSMUSE00000518660 Chr7:19736567..19736746 GCAGTCGGTCAAGAACAACA Chr7:19736663..19736682 59.88 50

*** Putative Vector Insertion (Chr 7: 19736747 - 19737824) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000235315 Chr7:19737825..19738075 TCTTGGGAACCTCAGTCCAC Chr7:19737883..19737902 60.09 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGGCCTTTGACAGGTGAG Chr7:19736733..19736753 59.84 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGGCCTTTGACAGGTGAG Chr7:19736733..19736753 59.84 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040824