Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14197
Trapped Gene
Ednra (ENSMUSG00000031616)
Vector Insertion
Chr 8: 80199011 - 80212967
Public Clones CMHD-GT_76F12-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 43% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000249482 (Chr8:80212968..80213095 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCATCACCGTCTTGAACCTC Chr8:80212988..80213007 60.67 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000249482 (Chr8:80212968..80213095 -)
Downstram Exon
ENSMUSE00000211161 (Chr8:80198812..80199010 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCATCACCGTCTTGAACCTC Chr8:80212988..80213007 60.67 55 GTACCATGACGAAGCCGATT Chr8:80198855..80198874 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000249495 Chr8:80247995..80248351 CTGCTTCCGAGGAGCTCTAA Chr8:80247996..80248015 59.85 55
upstream ENSMUSE00000249488 Chr8:80243927..80244401 GAGGCGTAATGGCTGACAAT Chr8:80244281..80244300 60.1 50
upstream ENSMUSE00000249482 Chr8:80212968..80213095 GCATCACCGTCTTGAACCTC Chr8:80212988..80213007 60.67 55

*** Putative Vector Insertion (Chr 8: 80199011 - 80212967) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000211161 Chr8:80198812..80199010 GTACCATGACGAAGCCGATT Chr8:80198855..80198874 59.96 50
downstream ENSMUSE00000249472 Chr8:80195416..80195568 AGCCACCAGTCCTTCACATC Chr8:80195518..80195537 60.12 55
downstream ENSMUSE00000211162 Chr8:80191698..80191831 AGCAGTTCACACCGGTTCTT Chr8:80191679..80191698 59.77 50
downstream ENSMUSE00000211164 Chr8:80191222..80191330 GCCAGGTTAATGCCGATGTA Chr8:80191270..80191289 60.86 50
downstream ENSMUSE00000401911 Chr8:80186928..80189015 CATCTGTGGCGTAATGGTTG Chr8:80188784..80188803 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCCTAGCCCTTTCTAGTGC Chr8:80212940..80212960 59.62 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCTAGCCCTTTCTAGTGC Chr8:80212940..80212960 59.62 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031616