Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1420
Trapped Gene
Sin3b (ENSMUSG00000031622)
Vector Insertion
Chr 8: 75277537 - 75280371
Public Clones CH0195 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000211242 (Chr8:75277444..75277536 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGACCCTGTGGAGGTACA Chr8:75277516..75277535 59.96 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000211242 (Chr8:75277444..75277536 +)
Downstram Exon
ENSMUSE00000581753 (Chr8:75280372..75280466 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGACCCTGTGGAGGTACA Chr8:75277516..75277535 59.96 60 TTCAGCAGGAAGCCTTCAGT Chr8:75280451..75280470 60.13 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000325243 Chr8:75247203..75247307 No primer for this exon
upstream ENSMUSE00000211240 Chr8:75247943..75248049 TACAACGGCTTCCTGGAGAT Chr8:75248006..75248025 59.69 50
upstream ENSMUSE00000211246 Chr8:75249436..75249589 TCGTGGGGTTTAATGCTTTC Chr8:75249498..75249517 59.94 45
upstream ENSMUSE00000211251 Chr8:75254980..75255177 CTTTCTGGACCACCCTGAGA Chr8:75255120..75255139 60.23 55
upstream ENSMUSE00000325260 Chr8:75257244..75257387 CAATCTTTTCCGTGGTCAGG Chr8:75257315..75257334 60.49 50
upstream ENSMUSE00000211258 Chr8:75263268..75263387 CACAACAAGAAACGCTCTCG Chr8:75263331..75263350 59.63 50
upstream ENSMUSE00000682179 Chr8:75263629..75263800 TGGTTTGGTTACTGCACAGC Chr8:75263659..75263678 59.76 50
upstream ENSMUSE00000211256 Chr8:75265373..75265462 ATACGGCACACTGCAGGAAT Chr8:75265426..75265445 60.55 50
upstream ENSMUSE00000211247 Chr8:75265709..75265827 AGAACTTTCTGCGCTGCATT Chr8:75265743..75265762 60.16 45
upstream ENSMUSE00000325221 Chr8:75268357..75268564 GCACTTCCCAAGACCTACCA Chr8:75268505..75268524 60.11 55
upstream ENSMUSE00000211243 Chr8:75268793..75268909 CCTACGAGGAGCAACTGCAT Chr8:75268866..75268885 60.42 55
upstream ENSMUSE00000211249 Chr8:75270309..75270547 CACCGCATCTATGGAGACAA Chr8:75270462..75270481 59.67 50
upstream ENSMUSE00000581754 Chr8:75271584..75271767 TCAACAAGATCTGGCGTGAG Chr8:75271628..75271647 59.98 50
upstream ENSMUSE00000211252 Chr8:75273618..75274167 GATCCTAGAGGACGCAGCAG Chr8:75273695..75273714 60.12 60
upstream ENSMUSE00000211248 Chr8:75274335..75274504 TCTCCGTGAGATGTTCACCA Chr8:75274429..75274448 60.25 50
upstream ENSMUSE00000211241 Chr8:75277066..75277239 CTCCAGATGTGTTCGTGCAG Chr8:75277158..75277177 60.46 55
upstream ENSMUSE00000211242 Chr8:75277444..75277536 GAGGACCCTGTGGAGGTACA Chr8:75277516..75277535 59.96 60

*** Putative Vector Insertion (Chr 8: 75277537 - 75280371) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000581753 Chr8:75280372..75280466 TTCAGCAGGAAGCCTTCAGT Chr8:75280451..75280470 60.13 50
downstream ENSMUSE00000581752 Chr8:75280747..75280951 CTCGGAATTGACGATGAACA Chr8:75280912..75280931 59.65 45
downstream ENSMUSE00000635998 Chr8:75281074..75281304 CTTGCAGGGTACCATGTCCT Chr8:75281223..75281242 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCCTGGACACAGAAGAGG Chr8:75277489..75277509 59.99 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTCCTGGACACAGAAGAGG Chr8:75277489..75277509 59.99 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031622