Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14203
Trapped Gene
Tet1 (ENSMUSG00000075009)
Vector Insertion
Chr 10: 62327610 - 62327883
Public Clones CMHD-GT_24A3-3 (cmhd) FHCRC-GT-S7-4D1 (fhcrc) (egtc)
Private Clones OST369005 (lexicon) OST43615 (lexicon) OST40538 (lexicon) OST38794 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666238 (Chr10:62327884..62328011 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGCAAGATGGCTACCTCGT Chr10:62327971..62327990 61.17 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666238 (Chr10:62327884..62328011 -)
Downstram Exon
ENSMUSE00000666237 (Chr10:62327556..62327609 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGCAAGATGGCTACCTCGT Chr10:62327971..62327990 61.17 55 TTTGGGCTTCTTTTCCCTCT Chr10:62327543..62327562 60.18 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666238 Chr10:62327884..62328011 AGGCAAGATGGCTACCTCGT Chr10:62327971..62327990 61.17 55

*** Putative Vector Insertion (Chr 10: 62327610 - 62327883) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000666237 Chr10:62327556..62327609 TTTGGGCTTCTTTTCCCTCT Chr10:62327543..62327562 60.18 45
downstream ENSMUSE00000643001 Chr10:62301845..62303126 CATGCCGTTCCTTATGGTCT Chr10:62302787..62302806 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCATTTCCCTCCATCTTTA Chr10:62327892..62327912 58.97 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACATTTTGCATCGTGACTGG Chr10:62327823..62327843 59.57 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCAAAAGCAGTTTGCAGAGC Chr10:62328020..62328040 61.08 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCAAAAGCAGTTTGCAGAGC Chr10:62328020..62328040 61.08 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075009