Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14219
Trapped Gene
Dok5 (ENSMUSG00000027560)
Vector Insertion
Chr 2: 170696432 - 170704673
Public Clones CMHD-GT_23A3-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000497478 (Chr2:170696311..170696431 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATATCACGAGGCAGCACAG Chr2:170696386..170696405 60.44 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000497478 (Chr2:170696311..170696431 +)
Downstram Exon
ENSMUSE00000496597 (Chr2:170704674..170705268 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATATCACGAGGCAGCACAG Chr2:170696386..170696405 60.44 55 TATCCAGTGCGTTTCCATGA Chr2:170705084..170705103 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000503662 Chr2:170557440..170557688 TTCACCGCATCACCTTGTTA Chr2:170557494..170557513 60.11 45
upstream ENSMUSE00000502770 Chr2:170626350..170626457 CAAGAAAGCTTCGAGCAAGG Chr2:170626376..170626395 60.26 50
upstream ENSMUSE00000266197 Chr2:170655340..170655454 GACACCTCGAAGACCTTTGC Chr2:170655424..170655443 59.85 55
upstream ENSMUSE00000170524 Chr2:170655569..170655688 ATCTTGAGGCAGACGAATGG Chr2:170655569..170655588 60.22 50
upstream ENSMUSE00000170522 Chr2:170658382..170658571 CACGTGGTTCACTTTTGAGG Chr2:170658545..170658564 59.18 50
upstream ENSMUSE00000266175 Chr2:170666920..170667055 GTGAGACTGGCGAAGGGTTA Chr2:170666925..170666944 60.26 55
upstream ENSMUSE00000497478 Chr2:170696311..170696431 CATATCACGAGGCAGCACAG Chr2:170696386..170696405 60.44 55

*** Putative Vector Insertion (Chr 2: 170696432 - 170704673) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000496597 Chr2:170704674..170705268 TATCCAGTGCGTTTCCATGA Chr2:170705084..170705103 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTATGTGTGCGGGTGACAT Chr2:170696394..170696414 60.88 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTATGTGTGCGGGTGACAT Chr2:170699394..170699414 60.88 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027560