Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14227
Trapped Gene
Nme2 (ENSMUSG00000020857)
Vector Insertion
Chr 11: 93811361 - 93813213
Public Clones CMHD-GT_69C10-3 (cmhd)
Private Clones OST17249 (lexicon)
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000460702 (Chr11:93813214..93813326 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000460702 (Chr11:93813214..93813326 -)
Downstram Exon
ENSMUSE00000110587 (Chr11:93811130..93811360 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000351001 Chr11:93817140..93817195 No primer for this exon
upstream ENSMUSE00000110580 Chr11:93816809..93816938 No primer for this exon
upstream ENSMUSE00000492655 Chr11:93816809..93817097 No primer for this exon
upstream ENSMUSE00000473358 Chr11:93814114..93814215 No primer for this exon
upstream ENSMUSE00000460702 Chr11:93813214..93813326 No primer for this exon

*** Putative Vector Insertion (Chr 11: 93811361 - 93813213) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000412222 Chr11:93811131..93811360 No primer for this exon
downstream ENSMUSE00000110587 Chr11:93811130..93811360 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTCAAAACCAGGCACCATC Chr11:93813241..93813261 59.8 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTCGTGACTGGGAAAACC Chr11:93813146..93813166 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020857