Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14245
Trapped Gene
Gas2l1 (ENSMUSG00000034201)
Vector Insertion
Chr 11: 4963828 - 4965098
Public Clones FHCRC-GT-S23-1G1 (fhcrc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000306494 (Chr11:4964840..4965097 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTTACTGCGCCTCAGTTTC Chr11:4964929..4964948 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000306494 (Chr11:4964840..4965097 -)
Downstram Exon
ENSMUSE00000306487 (Chr11:4963829..4964481 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTTACTGCGCCTCAGTTTC Chr11:4964929..4964948 60.01 55 GGAAACCTGAGGGGTAGCTC Chr11:4963915..4963934 60.07 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000455060 Chr11:4965218..4965303 No primer for this exon
upstream ENSMUSE00000595079 Chr11:4965218..4965280 No primer for this exon
upstream ENSMUSE00000306494 Chr11:4964840..4965097 CCTTACTGCGCCTCAGTTTC Chr11:4964929..4964948 60.01 55
upstream ENSMUSE00000306487 Chr11:4963829..4964481 GAGCTACCCCTCAGGTTTCC Chr11:4963937..4963956 60.07 60
upstream ENSMUSE00000713456 Chr11:4963829..4964481 GAGCTACCCCTCAGGTTTCC Chr11:4963937..4963956 60.07 60

*** Putative Vector Insertion (Chr 11: 4963828 - 4965098) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000306481 Chr11:4962597..4962704 TACTTCCCCTCGGAGACCTT Chr11:4962612..4962631 60.07 55
downstream ENSMUSE00000306475 Chr11:4962418..4962514 TAGAAGACGAGCAGCGACAA Chr11:4962396..4962415 59.89 50
downstream ENSMUSE00000306467 Chr11:4962158..4962329 GAGAAAGTCCCGGTCCTCTG Chr11:4962271..4962290 61.16 60
downstream ENSMUSE00000682013 Chr11:4960384..4961820 ACCATCAGTACCGCCTGTTC Chr11:4961469..4961488 60 55
downstream ENSMUSE00000409451 Chr11:4960381..4961820 ACCATCAGTACCGCCTGTTC Chr11:4961469..4961488 60 55
downstream ENSMUSE00000334039 Chr11:4956668..4956692 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCACTCACCCTCTCTGGAC Chr11:4965099..4965119 62.24 65 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTTCGTGACTGGGAAAAC Chr11:4965032..4965052 61.96 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034201