Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14249
Trapped Gene
Ebp (ENSMUSG00000031168)
Vector Insertion
Chr X: 7767204 - 7770007
Public Clones (sanger) FHCRC-GT-S21-9G1 (fhcrc) PST8830-NR (escells) IST12408G10 (tigm)
Private Clones OST437666 (lexicon) OST364067 (lexicon) OST272513 (lexicon) OST253581 (lexicon)
OST247876 (lexicon) OST225184 (lexicon) OST215179 (lexicon) OST203679 (lexicon)
OST197832 (lexicon) OST192584 (lexicon) OST192490 (lexicon) OST173106 (lexicon)
OST160399 (lexicon) OST125996 (lexicon) OST69156 (lexicon) OST17666 (lexicon)
OST14483 (lexicon) OST1205 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000207019 (ChrX:7769927..7770006 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTCGCAAGCCTGTGTTAGG ChrX:7769955..7769974 60.45 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000207019 (ChrX:7769927..7770006 -)
Downstram Exon
ENSMUSE00000207021 (ChrX:7767205..7767562 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTCGCAAGCCTGTGTTAGG ChrX:7769955..7769974 60.45 55 CCAACCAGGATATGCGAAGT ChrX:7767383..7767402 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000207019 ChrX:7769927..7770006 AGTCGCAAGCCTGTGTTAGG ChrX:7769955..7769974 60.45 55
upstream ENSMUSE00000207021 ChrX:7767205..7767562 ACTTCGCATATCCTGGTTGG ChrX:7767405..7767424 59.96 50

*** Putative Vector Insertion (Chr X: 7767204 - 7770007) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000207022 ChrX:7764009..7764045 TATCGGCTATCTCCCTTGGA ChrX:7763993..7764012 59.62 50
downstream ENSMUSE00000207018 ChrX:7763770..7763900 CTGTAGGACAAAGCGGAAGG ChrX:7763764..7763783 59.87 55
downstream ENSMUSE00000400606 ChrX:7762461..7762959 GCTGGAGTCCTTCGTGTAGC ChrX:7762881..7762900 60.02 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCAGGTCTTCCTGGAAAGT ChrX:7769970..7769990 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCAGGTCTTCCTGGAAAGT ChrX:7769970..7769990 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CGCAAGCCTGTGTTAGGAAG ChrX:7769950..7769970 60.95 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CGCAAGCCTGTGTTAGGAAG ChrX:7769950..7769970 60.95 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031168