Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14254
Trapped Gene
Ufc1 (ENSMUSG00000062963)
Vector Insertion
Chr 1: 173224764 - 173225156
Public Clones FHCRC-GT-S21-8E1 (fhcrc) IST12922A9 (tigm) IST12778F11 (tigm) IST14151F9 (tigm)
Private Clones OST66605 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000474117 (Chr1:173225052..173225155 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTCCGGTGATTTAATGAT Chr1:173225103..173225122 58.86 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000474117 (Chr1:173225052..173225155 -)
Downstram Exon
ENSMUSE00000472330 (Chr1:173224765..173224958 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTCCGGTGATTTAATGAT Chr1:173225103..173225122 58.86 45 TCCTCCTTTAGTCGCTGCAC Chr1:173224762..173224781 60.54 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000474117 Chr1:173225052..173225155 GGCTCCGGTGATTTAATGAT Chr1:173225103..173225122 58.86 45
upstream ENSMUSE00000472330 Chr1:173224765..173224958 GACGCCGTGAGTAAGTGACA Chr1:173224929..173224948 59.9 55
upstream ENSMUSE00000687392 Chr1:173224765..173224911 GTGCAGCGACTAAAGGAGGA Chr1:173224784..173224803 60.54 55

*** Putative Vector Insertion (Chr 1: 173224764 - 173225156) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000471460 Chr1:173220280..173220347 CTCCAGTCGGAACCAATCAT Chr1:173220278..173220297 59.93 50
downstream ENSMUSE00000482934 Chr1:173220015..173220078 ACCAGCATTTTCCAAACCAC Chr1:173220037..173220056 59.84 45
downstream ENSMUSE00000510324 Chr1:173219649..173219725 TCCGGAGCAGTAGTGGGATA Chr1:173219672..173219691 60.62 55
downstream ENSMUSE00000506703 Chr1:173219302..173219392 GGGCCATGAGATGAGCTAGT Chr1:173219285..173219304 59.27 55
downstream ENSMUSE00000687391 Chr1:173218696..173219102 GTCCTTCATTGGCTGCATTT Chr1:173218995..173219014 60.08 45
downstream ENSMUSE00000518418 Chr1:173218694..173219102 GTCCTTCATTGGCTGCATTT Chr1:173218995..173219014 60.08 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCCAAGATTGCTTCTGAGC Chr1:173225146..173225166 60.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCCAAGATTGCTTCTGAGC Chr1:173225146..173225166 60.48 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTAATCGCCTTGCAGCACAT Chr1:173224981..173225001 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CATTCGTGACTGGGAAAACC Chr1:173224984..173225004 60.35 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062963