Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14281
Trapped Gene
Usp49 (ENSMUSG00000023984)
Vector Insertion
Chr 17: 47767865 - 47786898
Public Clones D093G11 (ggtc) (cmhd) CMHD-GT_407H10-3 (cmhd) FHCRC-GT-S21-12D1 (fhcrc) IST10496H1 (tigm)
IST10496H1 (tigm) IST14409B5 (tigm)
Private Clones OST426705 (lexicon) OST414209 (lexicon) OST409161 (lexicon) OST379556 (lexicon)
OST379221 (lexicon) OST379105 (lexicon) OST355821 (lexicon) OST348115 (lexicon)
OST343562 (lexicon) OST287164 (lexicon) OST283309 (lexicon) OST266312 (lexicon)
OST238110 (lexicon) OST109030 (lexicon) OST104840 (lexicon) OST104838 (lexicon)
OST79895 (lexicon) OST62391 (lexicon) OST62368 (lexicon) OST56947 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000497657 (Chr17:47767639..47767864 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGGAGTGGGAAACGAATGT Chr17:47767742..47767761 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000497657 (Chr17:47767639..47767864 +)
Downstram Exon
ENSMUSE00000503992 (Chr17:47786899..47786972 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGGAGTGGGAAACGAATGT Chr17:47767742..47767761 59.97 50 CCATCGCCTTCCATATTCTC Chr17:47786957..47786976 59.49 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000497657 Chr17:47767639..47767864 CAGGAGTGGGAAACGAATGT Chr17:47767742..47767761 59.97 50

*** Putative Vector Insertion (Chr 17: 47767865 - 47786898) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000503992 Chr17:47786899..47786972 CCATCGCCTTCCATATTCTC Chr17:47786957..47786976 59.49 50
downstream ENSMUSE00000136950 Chr17:47808993..47810367 AGCATGGCAAAGGGTGATAC Chr17:47810159..47810178 59.96 50
downstream ENSMUSE00000319461 Chr17:47811665..47811869 AGATCCCAAAAGGGCTCAAT Chr17:47811723..47811742 59.9 45
downstream ENSMUSE00000136947 Chr17:47815793..47815901 TTTAAGGTGTAGCCGGAGGA Chr17:47815896..47815915 59.7 50
downstream ENSMUSE00000450395 Chr17:47816613..47816818 GACCACTGCGGAGAGATCAT Chr17:47816757..47816776 60.23 55
downstream ENSMUSE00000319430 Chr17:47817631..47821015 AGGAGTGTCCACGGCATAAC Chr17:47818510..47818529 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGAGAAGTGGGGGTAATCG Chr17:47779902..47779922 59.54 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGGGGAAAAGACTGAGAA Chr17:47779889..47779909 59.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023984