Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14287
Trapped Gene
Creb3l1 (ENSMUSG00000027230)
Vector Insertion
Chr 2: 91822486 - 91823590
Public Clones FHCRC-GT-S21-10E1 (fhcrc) IST12981F11 (tigm) IST15099E10 (tigm)
Private Clones OST14274 (lexicon)
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000370902 (Chr2:91823322..91823589 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAAGGAGTGGTTCCATGAC Chr2:91823324..91823343 60.36 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000370902 (Chr2:91823322..91823589 -)
Downstram Exon
ENSMUSE00000502278 (Chr2:91822487..91823164 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAAGGAGTGGTTCCATGAC Chr2:91823324..91823343 60.36 55 TAGCAAAGCCCGCACTAACT Chr2:91822623..91822642 60.04 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000357520 Chr2:91864161..91864327 CTGGACTTGGGAGACCTGAA Chr2:91864186..91864205 60.23 55
upstream ENSMUSE00000167183 Chr2:91842002..91842230 TTGTGCCTGTCAAGATGGAG Chr2:91842015..91842034 59.83 50
upstream ENSMUSE00000167189 Chr2:91835414..91835598 AAACAAGCTGTGCTCCATCA Chr2:91835551..91835570 59.44 45
upstream ENSMUSE00000167186 Chr2:91833428..91833506 TGCCAGTGATCAAAGCAGAG Chr2:91833465..91833484 60.14 50
upstream ENSMUSE00000167193 Chr2:91832044..91832201 ACCTCGTACAGATGCCTCCA Chr2:91832179..91832198 60.68 55
upstream ENSMUSE00000167188 Chr2:91831283..91831432 GAAGAGGAGAAGCGGACCTT Chr2:91831377..91831396 59.96 55
upstream ENSMUSE00000167192 Chr2:91831066..91831124 GCCGCAAGAAGAAGGAGTAT Chr2:91831086..91831105 58.56 50
upstream ENSMUSE00000167191 Chr2:91830864..91830932 TGAGCTGTGGAAGAAAGTGG Chr2:91830886..91830905 59.01 50
upstream ENSMUSE00000360669 Chr2:91827193..91827292 TCTCCAGACCGTACAAGATGG Chr2:91827222..91827242 60.12 52.38
upstream ENSMUSE00000299441 Chr2:91826318..91826444 TCTCTTCCGGCTCAATGACT Chr2:91826367..91826386 59.95 50
upstream ENSMUSE00000370902 Chr2:91823322..91823589 CCAAGGAGTGGTTCCATGAC Chr2:91823324..91823343 60.36 55
upstream ENSMUSE00000502278 Chr2:91822487..91823164 AGTTAGTGCGGGCTTTGCTA Chr2:91822645..91822664 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTCCCGAAGCCTACTGTT Chr2:91823566..91823586 60.62 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTTCCCGAAGCCTACTGTT Chr2:91823566..91823586 60.62 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGAGTGGTTCCATGACAGGT Chr2:91823318..91823338 59.82 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGAGTGGTTCCATGACAGGT Chr2:91823318..91823338 59.82 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027230