Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14292
Trapped Gene
Rps8 (ENSMUSG00000047675)
Vector Insertion
Chr 4: 116827242 - 116827713
Public Clones FHCRC-GT-S20-8B1 (fhcrc) PST14182-NR (escells) PST1200 (escells) PST14258-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000465282 (Chr4:116827613..116827712 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTACCGTGCCCTGAGATTG Chr4:116827644..116827663 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000465282 (Chr4:116827613..116827712 -)
Downstram Exon
ENSMUSE00000464404 (Chr4:116827243..116827418 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTACCGTGCCCTGAGATTG Chr4:116827644..116827663 60.13 55 GTACGGCGTGCTGTCAATAA Chr4:116827281..116827300 59.76 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662321 Chr4:116828663..116828737 TTAGAAACCGGACCGTGAAG Chr4:116828701..116828720 60.1 50
upstream ENSMUSE00000705664 Chr4:116828663..116828689 No primer for this exon
upstream ENSMUSE00000662320 Chr4:116828176..116828282 GGGTAAGCGAAAACCCTACC Chr4:116828223..116828242 59.83 55
upstream ENSMUSE00000465282 Chr4:116827613..116827712 AGTACCGTGCCCTGAGATTG Chr4:116827644..116827663 60.13 55
upstream ENSMUSE00000464404 Chr4:116827243..116827418 ACCGACAGTGGTACGAGTCC Chr4:116827285..116827304 60.03 60

*** Putative Vector Insertion (Chr 4: 116827242 - 116827713) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000463465 Chr4:116826904..116827033 GCTGCTGATTTTGGCATTCT Chr4:116826919..116826938 60.36 45
downstream ENSMUSE00000339525 Chr4:116826441..116826592 CTGGTCGTGAGGCAATACAG Chr4:116826550..116826569 59.31 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGCATACACACAGTCCGAGT Chr4:116827679..116827699 59.78 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGCATACACACAGTCCGAGT Chr4:116827679..116827699 59.78 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047675