Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14303
Trapped Gene
Ucp2 (ENSMUSG00000033685)
Vector Insertion
Chr 7: 107642885 - 107645234
Public Clones FHCRC-GT-S20-3G1 (fhcrc) IST14852F10 (tigm) IST12405B7 (tigm) IST12286D3 (tigm)
IST12350C4 (tigm)
Private Clones OST456502 (lexicon) OST452424 (lexicon) OST417030 (lexicon) OST353610 (lexicon)
OST346971 (lexicon) OST313283 (lexicon) OST277044 (lexicon) OST250726 (lexicon)
OST243953 (lexicon) OST223340 (lexicon) OST191909 (lexicon) OST101095 (lexicon)
OST94582 (lexicon) OST39966 (lexicon) OST35773 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000202263 (Chr7:107642723..107642884 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCCAGCCATTTTCTATGG Chr7:107642754..107642773 59.52 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000202263 (Chr7:107642723..107642884 +)
Downstram Exon
ENSMUSE00000202236 (Chr7:107645235..107645457 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCCAGCCATTTTCTATGG Chr7:107642754..107642773 59.52 50 ACATCTGTGGCCTTGAAACC Chr7:107645360..107645379 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000390980 Chr7:107641880..107641974 ACAGCCTTCTGCACTCCTGT Chr7:107641939..107641958 60.06 55
upstream ENSMUSE00000202263 Chr7:107642723..107642884 CTCCCAGCCATTTTCTATGG Chr7:107642754..107642773 59.52 50

*** Putative Vector Insertion (Chr 7: 107642885 - 107645234) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000202236 Chr7:107645235..107645457 ACATCTGTGGCCTTGAAACC Chr7:107645360..107645379 59.97 50
downstream ENSMUSE00000202257 Chr7:107645604..107645814 ATTGTAGAGGCTGCGTGGAC Chr7:107645720..107645739 60.28 55
downstream ENSMUSE00000202264 Chr7:107646587..107646781 TCGTGCAATGGTCTTGTAGG Chr7:107646756..107646775 59.72 50
downstream ENSMUSE00000202237 Chr7:107646857..107646958 TGTCATGAGGTTGGCTTTCA Chr7:107646960..107646979 60.24 45
downstream ENSMUSE00000202235 Chr7:107647245..107647425 GAGCATGGTAAGGGCACAGT Chr7:107647396..107647415 60.14 55
downstream ENSMUSE00000449447 Chr7:107647745..107648134 CATGGAGAGGCTCAGAAAGG Chr7:107647873..107647892 59.94 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTAAGGAGTCCCGGCTAAG Chr7:107642885..107642905 60.09 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTAAGGAGTCCCGGCTAAG Chr7:107642885..107642905 60.09 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033685