Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1431
Trapped Gene
Fbxl17 (ENSMUSG00000023965)
Vector Insertion
Chr 17: 63706228 - 63734293
Public Clones CG0713 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 58% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000136696 (Chr17:63734294..63734401 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTGGCTTCATGGGTTGTTC Chr17:63734328..63734347 60.36 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000136696 (Chr17:63734294..63734401 -)
Downstram Exon
ENSMUSE00000136692 (Chr17:63706097..63706227 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTGGCTTCATGGGTTGTTC Chr17:63734328..63734347 60.36 50 ACGGAGGTCTAAGCTGGACA Chr17:63706176..63706195 59.87 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000385763 Chr17:63848374..63848649 CCGAGATCCCAGACATCAAC Chr17:63848401..63848420 60.47 55
upstream ENSMUSE00000693382 Chr17:63842038..63842102 GACCTACAGCCCTTGGTCAT Chr17:63842044..63842063 59.02 55
upstream ENSMUSE00000308088 Chr17:63840114..63840236 TTTGCAAGTACTGGCGTGAC Chr17:63840168..63840187 59.91 50
upstream ENSMUSE00000136693 Chr17:63837061..63837318 ACGTAGGCAACCAGGACAAG Chr17:63837085..63837104 60.17 55
upstream ENSMUSE00000136695 Chr17:63820757..63820888 AGACATCCATTTTGGCCAGT Chr17:63820843..63820862 59.41 45
upstream ENSMUSE00000693381 Chr17:63800931..63801014 TGGTTTTGTGCTGCTGGATA Chr17:63800984..63801003 60.26 45
upstream ENSMUSE00000136696 Chr17:63734294..63734401 GTTGGCTTCATGGGTTGTTC Chr17:63734328..63734347 60.36 50

*** Putative Vector Insertion (Chr 17: 63706228 - 63734293) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136692 Chr17:63706097..63706227 ACGGAGGTCTAAGCTGGACA Chr17:63706176..63706195 59.87 55
downstream ENSMUSE00000307985 Chr17:63574374..63574450 TCCTTCCTTTGCAATGACCT Chr17:63574401..63574420 59.67 45
downstream ENSMUSE00000358045 Chr17:63429770..63429912 ATCCGACGTCCACAGTCTCT Chr17:63429837..63429856 59.71 55
downstream ENSMUSE00000439569 Chr17:63407131..63409760 ATATTGCCAGCTGGTTTTGG Chr17:63407755..63407774 59.96 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCGATGGCGTCTTTAATC Chr17:63725237..63725257 59.81 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGTCGGGTATAATGGAAGA Chr17:63725292..63725312 59.78 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023965