Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14313
Trapped Gene
Ubtd1 (ENSMUSG00000025171)
Vector Insertion
Chr 19: 42056499 - 42106378
Public Clones (sanger) D050A05 (ggtc) CMHD-GT_503D8-3 (cmhd) CMHD-GT_534B7-5S (cmhd)
CMHD-GT_534B7-3 (cmhd) FHCRC-GT-S20-12A1 (fhcrc) IST14818D11 (tigm)
IST15088G11 (tigm)
Private Clones OST432676 (lexicon) OST427704 (lexicon) OST386089 (lexicon) OST368604 (lexicon)
OST367849 (lexicon) OST356489 (lexicon) OST333352 (lexicon) OST330410 (lexicon)
OST242967 (lexicon) OST99786 (lexicon) OST95879 (lexicon) OST90124 (lexicon)
OST73846 (lexicon) OST55197 (lexicon) OST45511 (lexicon) OST42778 (lexicon)
OST36309 (lexicon) OST31044 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000359283 (Chr19:42056253..42056498 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCCAGGAGCTCTCGATGTC Chr19:42056302..42056321 59.36 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000359283 (Chr19:42056253..42056498 +)
Downstram Exon
ENSMUSE00000148508 (Chr19:42106379..42106606 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCCAGGAGCTCTCGATGTC Chr19:42056302..42056321 59.36 55 GGTCATTAGCTTCAGCAGCA Chr19:42106558..42106577 59.18 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000359283 Chr19:42056253..42056498 ATCCAGGAGCTCTCGATGTC Chr19:42056302..42056321 59.36 55

*** Putative Vector Insertion (Chr 19: 42056499 - 42106378) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000148508 Chr19:42106379..42106606 GGTCATTAGCTTCAGCAGCA Chr19:42106558..42106577 59.18 50
downstream ENSMUSE00000384994 Chr19:42108079..42109131 CCAGCTCGTCATAGCATTCA Chr19:42108111..42108130 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGAAAGAAGGCAGGCAGGT Chr19:42092487..42092507 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGAAAGAAGGCAGGCAGGT Chr19:42092487..42092507 60.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025171