Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14321
Trapped Gene
Ranbp17 (ENSMUSG00000040594)
Vector Insertion
Chr 11: 33404681 - 33413631
Public Clones E123D10 (ggtc) D174D10 (ggtc) E048E08 (ggtc) D174D10 (ggtc) E048E08 (ggtc)
FHCRC-GT-S19-5G1 (fhcrc) FHCRC-GT-S8-3B2 (fhcrc) IST10055B11 (tigm)
IST12589F6 (tigm)
Private Clones OST322994 (lexicon) OST274262 (lexicon) OST271113 (lexicon) OST240195 (lexicon)
OST233367 (lexicon) OST210554 (lexicon) OST184060 (lexicon) OST174588 (lexicon)
OST172754 (lexicon) OST149960 (lexicon) OST124527 (lexicon) OST81059 (lexicon)
OST65600 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679977 (Chr11:33413602..33413630 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679977 (Chr11:33413602..33413630 -)
Downstram Exon
ENSMUSE00000662692 (Chr11:33404682..33404828 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGAGACATTCTGGGCTGTCA Chr11:33404692..33404711 60.4 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662693 Chr11:33413602..33413635 No primer for this exon
upstream ENSMUSE00000679977 Chr11:33413602..33413630 No primer for this exon
upstream ENSMUSE00000662692 Chr11:33404682..33404828 GGGACCGATCTCACTGAAAG Chr11:33404767..33404786 59.65 55

*** Putative Vector Insertion (Chr 11: 33404681 - 33413631) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000251467 Chr11:33400680..33400770 AGACATGTTGCTGCAAGGAG Chr11:33400714..33400733 59.04 50
downstream ENSMUSE00000251462 Chr11:33393251..33393417 GTTGGGACGCCACATAATTC Chr11:33393363..33393382 60.2 50
downstream ENSMUSE00000251454 Chr11:33391327..33391392 CACTCCTATTATGCAGTGTTCCA Chr11:33391341..33391363 59.17 43.48
downstream ENSMUSE00000251447 Chr11:33387643..33387747 TGTTTTGCTGAAGGTCTGGA Chr11:33387697..33387716 59.42 45
downstream ENSMUSE00000336965 Chr11:33385918..33386083 GCCCAGGAAGTCAAAGTTCA Chr11:33385960..33385979 60.23 50
downstream ENSMUSE00000251437 Chr11:33383006..33383079 GGTGGGAGCGAGTGATACAA Chr11:33383000..33383019 61.07 55
downstream ENSMUSE00000251426 Chr11:33381022..33381141 No primer for this exon
downstream ENSMUSE00000251419 Chr11:33379143..33379289 AAACGAGCCAAAAATCGACA Chr11:33379215..33379234 60.62 40
downstream ENSMUSE00000251411 Chr11:33378164..33378336 ATTCCAAACGGGACGTGATA Chr11:33378161..33378180 60.19 45
downstream ENSMUSE00000251406 Chr11:33374887..33375080 GGAACACGGTAGCAGTGTCA Chr11:33375015..33375034 59.75 55
downstream ENSMUSE00000679976 Chr11:33372416..33375080 GAAATGCCACCAGCCTACAT Chr11:33373562..33373581 59.96 50
downstream ENSMUSE00000251401 Chr11:33352444..33352549 CGGCAGGATAGTTCTCCATC Chr11:33352422..33352441 59.65 55
downstream ENSMUSE00000251395 Chr11:33341803..33341938 TCTCATTGGTGCAGTGAGGT Chr11:33341861..33341880 59.26 50
downstream ENSMUSE00000251393 Chr11:33229471..33229544 TTCGTCATGAATGTTTCCAGA Chr11:33229452..33229472 59.11 38.1
downstream ENSMUSE00000662691 Chr11:33228444..33228524 GAACTGAAGCGTCCTGGAGA Chr11:33228442..33228461 60.53 55
downstream ENSMUSE00000662690 Chr11:33218428..33218491 TCAGCATGAATTTCACAGCA Chr11:33218417..33218436 58.94 40
downstream ENSMUSE00000251374 Chr11:33218239..33218347 TACCATCAGAAGGCGAGTGA Chr11:33218224..33218243 59.39 50
downstream ENSMUSE00000405819 Chr11:33202767..33202870 AGAGACTGTGAGAGGCAGCA Chr11:33202799..33202818 58.86 55
downstream ENSMUSE00000251358 Chr11:33197342..33197430 TGTTCAGTGCAAAGGCAATC Chr11:33197354..33197373 59.85 45
downstream ENSMUSE00000251350 Chr11:33189564..33189671 TGCATCAGTTCTGCCAAGAG Chr11:33189548..33189567 60.14 50
downstream ENSMUSE00000251342 Chr11:33183908..33183990 TCATTTTGCTGGCTTCTCTG Chr11:33183898..33183917 59.15 45
downstream ENSMUSE00000251336 Chr11:33166110..33166324 ATGCCCTTGAGTTTCATTGG Chr11:33166236..33166255 59.93 45
downstream ENSMUSE00000251331 Chr11:33164636..33164774 GTGGTCCTGGGTGAGACATT Chr11:33164693..33164712 59.82 55
downstream ENSMUSE00000406897 Chr11:33143110..33143276 AGTCTCTGACCAGCCTGCAT Chr11:33143128..33143147 60.02 55
downstream ENSMUSE00000251644 Chr11:33119171..33119269 GACCACTGGTTCCGACAATC Chr11:33119192..33119211 60.37 55
downstream ENSMUSE00000251640 Chr11:33117292..33117419 ATCAGACTGGCCCTCAGTTC Chr11:33117369..33117388 59.26 55
downstream ENSMUSE00000662689 Chr11:33112422..33113498 AGGTTTGATGGGTCACAAGC Chr11:33112504..33112523 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCCAATAATCGCCTTGCAG Chr11:33410566..33410586 61.09 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGCTTCATTGTTGAAGGA Chr11:33404594..33404614 58.85 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGTTCCAAGTGGCTCAGGAA Chr11:33410568..33410588 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGTTCCAAGTGGCTCAGGAA Chr11:33410568..33410588 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040594