Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14322
Trapped Gene
Mif4gd (ENSMUSG00000020743)
Vector Insertion
Chr 11: 115473216 - 115474193
Public Clones FHCRC-GT-S13-10E1 (fhcrc) FHCRC-GT-S19-5D1 (fhcrc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000670200 (Chr11:115474099..115474192 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000670200 (Chr11:115474099..115474192 -)
Downstram Exon
ENSMUSE00000670201 (Chr11:115473217..115473817 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000375986 Chr11:115474099..115474236 No primer for this exon
upstream ENSMUSE00000670200 Chr11:115474099..115474192 No primer for this exon
upstream ENSMUSE00000108917 Chr11:115473217..115473348 No primer for this exon
upstream ENSMUSE00000670201 Chr11:115473217..115473817 No primer for this exon
upstream ENSMUSE00000716843 Chr11:115473217..115473348 No primer for this exon

*** Putative Vector Insertion (Chr 11: 115473216 - 115474193) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000108910 Chr11:115470853..115470962 No primer for this exon
downstream ENSMUSE00000108916 Chr11:115470594..115470749 No primer for this exon
downstream ENSMUSE00000108912 Chr11:115470375..115470467 No primer for this exon
downstream ENSMUSE00000670199 Chr11:115470375..115470410 No primer for this exon
downstream ENSMUSE00000670198 Chr11:115469463..115469927 No primer for this exon
downstream ENSMUSE00000108914 Chr11:115469235..115469927 No primer for this exon
downstream ENSMUSE00000705803 Chr11:115469232..115469927 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCAAGACCAACAACTTCA Chr11:115474161..115474181 60.28 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGCAAGACCAACAACTTCA Chr11:115474161..115474181 60.28 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020743