Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14325
Trapped Gene
Prr6 (ENSMUSG00000018509)
Vector Insertion
Chr 11: 62340993 - 62347457
Public Clones CMHD-GT_408E1-3 (cmhd) (cmhd) FHCRC-GT-S19-4G1 (fhcrc) IST10086B2 (tigm)
Private Clones OST434255 (lexicon) OST428801 (lexicon) OST363765 (lexicon) OST358535 (lexicon)
OST326862 (lexicon) OST305478 (lexicon) OST293472 (lexicon) OST259305 (lexicon)
OST242121 (lexicon) OST198021 (lexicon) OST33569 (lexicon) OST26631 (lexicon)
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000106583 (Chr11:62347387..62347456 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000106583 (Chr11:62347387..62347456 -)
Downstram Exon
ENSMUSE00000106584 (Chr11:62340994..62341108 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000335488 Chr11:62352358..62352763 No primer for this exon
upstream ENSMUSE00000106582 Chr11:62349784..62349882 No primer for this exon
upstream ENSMUSE00000106583 Chr11:62347387..62347456 No primer for this exon
upstream ENSMUSE00000106584 Chr11:62340994..62341108 No primer for this exon

*** Putative Vector Insertion (Chr 11: 62340993 - 62347457) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000106587 Chr11:62338448..62338789 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGACCCTTGCTCTCTCTCT Chr11:62344457..62344477 61.06 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTAGGGGAAAGACCAGGTG Chr11:62344432..62344452 59.02 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATGGGTGGGTCTTCTGTTTG Chr11:62344369..62344389 59.82 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATGGGTGGGTCTTCTGTTTG Chr11:62344369..62344389 59.82 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018509