Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14331
Trapped Gene
OTTMUSG00000016580 (ENSMUSG00000078868)
Vector Insertion
Chr 2: 177102036 - 177109074
Public Clones (sanger) 5SD179B02 (ggtc) (ggtc) 3SD101B08 (ggtc) 5SD060H06 (ggtc)
(ggtc) 5SD115G08 (ggtc) (ggtc) (ggtc) 3SD060H06 (ggtc) (ggtc)
3SD115G08 (ggtc) (ggtc) FHCRC-GT-S19-10H1 (fhcrc) IST14469B12 (tigm)
IST11083A6 (tigm) IST11528D1 (tigm) IST11262D4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000711018 (Chr2:177109010..177109073 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTCCCAAGCTCAGAACTCC Chr2:177109017..177109036 60.39 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000711018 (Chr2:177109010..177109073 -)
Downstram Exon
ENSMUSE00000678622 (Chr2:177102037..177102163 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTCCCAAGCTCAGAACTCC Chr2:177109017..177109036 60.39 55 AGCCCACTCTTCCTGAGTGA Chr2:177102088..177102107 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711018 Chr2:177109010..177109073 TGTCCCAAGCTCAGAACTCC Chr2:177109017..177109036 60.39 55
upstream ENSMUSE00000678622 Chr2:177102037..177102163 GGCTTTGCTGGATCCTTCTC Chr2:177102094..177102113 61.24 55

*** Putative Vector Insertion (Chr 2: 177102036 - 177109074) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678620 Chr2:177101769..177101829 No primer for this exon
downstream ENSMUSE00000678615 Chr2:177099225..177100614 TCGGAGATGACTGCTTTGTG Chr2:177099419..177099438 59.98 50
downstream ENSMUSE00000678619 Chr2:177096237..177100614 TCGGAGATGACTGCTTTGTG Chr2:177099419..177099438 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTGTGGGTCTGGTTTAGC Chr2:177103053..177103073 60.11 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTGTGGGTCTGGTTTAGC Chr2:177103053..177103073 60.11 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078868