Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14337
Trapped Gene
Dip2c (ENSMUSG00000048264)
Vector Insertion
Chr 13: 9627350 - 9633967
Public Clones E080G08 (ggtc) E080G08 (ggtc) FHCRC-GT-S18-7G1 (fhcrc)
Private Clones OST63964 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000115129 (Chr13:9627219..9627349 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTGCGAGCTTTACCCTTC Chr13:9627264..9627283 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000115129 (Chr13:9627219..9627349 +)
Downstram Exon
ENSMUSE00000115127 (Chr13:9633968..9634136 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTGCGAGCTTTACCCTTC Chr13:9627264..9627283 60.01 55 GCTCCATCACCGAATAGGAA Chr13:9634098..9634117 60.04 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684802 Chr13:9276228..9276312 No primer for this exon
upstream ENSMUSE00000482344 Chr13:9492349..9492422 No primer for this exon
upstream ENSMUSE00000684801 Chr13:9492351..9492422 No primer for this exon
upstream ENSMUSE00000452316 Chr13:9505825..9505935 CCTCAGGGTCTCGAGATGAA Chr13:9505903..9505922 60.34 55
upstream ENSMUSE00000684778 Chr13:9505825..9505935 CCTCAGGGTCTCGAGATGAA Chr13:9505903..9505922 60.34 55
upstream ENSMUSE00000115147 Chr13:9532498..9532623 GGCAGTACCTATGCCTTCCA Chr13:9532553..9532572 60.1 55
upstream ENSMUSE00000684777 Chr13:9532498..9532623 GGCAGTACCTATGCCTTCCA Chr13:9532553..9532572 60.1 55
upstream ENSMUSE00000115125 Chr13:9535902..9536111 CAGCATCAACATGGAGCATT Chr13:9535975..9535994 59.68 45
upstream ENSMUSE00000684776 Chr13:9535902..9536111 CAGCATCAACATGGAGCATT Chr13:9535975..9535994 59.68 45
upstream ENSMUSE00000251820 Chr13:9549430..9549564 TGCACCTCCTGATGTAACCA Chr13:9549440..9549459 60.11 50
upstream ENSMUSE00000684774 Chr13:9549430..9549564 TGCACCTCCTGATGTAACCA Chr13:9549440..9549459 60.11 50
upstream ENSMUSE00000643937 Chr13:9550992..9551111 GTAGCCGGGTATCAGCAAAA Chr13:9551004..9551023 60.1 50
upstream ENSMUSE00000684798 Chr13:9550992..9551111 GTAGCCGGGTATCAGCAAAA Chr13:9551004..9551023 60.1 50
upstream ENSMUSE00000684773 Chr13:9552520..9552717 CAAACTGGCCACCCTCTTTA Chr13:9552601..9552620 60.1 50
upstream ENSMUSE00000684797 Chr13:9552520..9552717 CAAACTGGCCACCCTCTTTA Chr13:9552601..9552620 60.1 50
upstream ENSMUSE00000684772 Chr13:9559917..9560008 CTATGGTACGGCCTGGAGAC Chr13:9559986..9560005 59.57 60
upstream ENSMUSE00000684795 Chr13:9559917..9560008 CTATGGTACGGCCTGGAGAC Chr13:9559986..9560005 59.57 60
upstream ENSMUSE00000115140 Chr13:9562360..9562470 ATGGTGGCCTTCTATGGTTG Chr13:9562399..9562418 59.81 50
upstream ENSMUSE00000684771 Chr13:9562360..9562470 ATGGTGGCCTTCTATGGTTG Chr13:9562399..9562418 59.81 50
upstream ENSMUSE00000115141 Chr13:9567077..9567200 GGTTTCTTGCTTGGAAGCTG Chr13:9567098..9567117 59.99 50
upstream ENSMUSE00000684770 Chr13:9567077..9567200 GGTTTCTTGCTTGGAAGCTG Chr13:9567098..9567117 59.99 50
upstream ENSMUSE00000513357 Chr13:9567547..9567656 TAAACCTCCTCGGGATTGGT Chr13:9567593..9567612 60.68 50
upstream ENSMUSE00000684769 Chr13:9567547..9567656 TAAACCTCCTCGGGATTGGT Chr13:9567593..9567612 60.68 50
upstream ENSMUSE00000115135 Chr13:9567837..9567939 GTGTGACCGTGACGAGGATA Chr13:9567868..9567887 59.55 55
upstream ENSMUSE00000684768 Chr13:9567837..9567939 GTGTGACCGTGACGAGGATA Chr13:9567868..9567887 59.55 55
upstream ENSMUSE00000115133 Chr13:9570296..9570360 AAGAAAGATGTGGGGCTCTG Chr13:9570325..9570344 59.28 50
upstream ENSMUSE00000684767 Chr13:9570296..9570360 AAGAAAGATGTGGGGCTCTG Chr13:9570325..9570344 59.28 50
upstream ENSMUSE00000115157 Chr13:9574380..9574473 AGCATCCCATACTCGCTGAT Chr13:9574407..9574426 59.68 50
upstream ENSMUSE00000684766 Chr13:9574380..9574473 AGCATCCCATACTCGCTGAT Chr13:9574407..9574426 59.68 50
upstream ENSMUSE00000115137 Chr13:9574608..9574727 ACATGCACTGGGCACTTGTA Chr13:9574635..9574654 60.18 50
upstream ENSMUSE00000684764 Chr13:9574608..9574727 ACATGCACTGGGCACTTGTA Chr13:9574635..9574654 60.18 50
upstream ENSMUSE00000572019 Chr13:9576050..9576164 CCTTCGACAGGAGGTCATCT Chr13:9576099..9576118 59.25 55
upstream ENSMUSE00000684763 Chr13:9576050..9576164 CCTTCGACAGGAGGTCATCT Chr13:9576099..9576118 59.25 55
upstream ENSMUSE00000684762 Chr13:9583251..9583276 CGTGGGTATGGAAGGTGTTC Chr13:9583252..9583271 60.23 55
upstream ENSMUSE00000684793 Chr13:9583251..9583267 No primer for this exon
upstream ENSMUSE00000684792 Chr13:9591990..9592004 No primer for this exon
upstream ENSMUSE00000520435 Chr13:9600625..9600742 GGACGAGGTGTGCTATCCAT Chr13:9600631..9600650 59.96 55
upstream ENSMUSE00000684791 Chr13:9600632..9600742 GGGCTGACCTATGGTGTGAT Chr13:9600655..9600674 59.81 55
upstream ENSMUSE00000251706 Chr13:9603735..9603871 CTCTGGCATGACCAAGAACA Chr13:9603844..9603863 59.83 50
upstream ENSMUSE00000684760 Chr13:9603735..9603871 CTCTGGCATGACCAAGAACA Chr13:9603844..9603863 59.83 50
upstream ENSMUSE00000115134 Chr13:9605569..9605777 ACGGCCTGATGGTAGTCAGT Chr13:9605681..9605700 59.6 55
upstream ENSMUSE00000684759 Chr13:9605569..9605777 ACGGCCTGATGGTAGTCAGT Chr13:9605681..9605700 59.6 55
upstream ENSMUSE00000572018 Chr13:9608190..9608304 CAGTTTCCAGTGGATGAGCA Chr13:9608274..9608293 59.83 50
upstream ENSMUSE00000684758 Chr13:9608190..9608304 CAGTTTCCAGTGGATGAGCA Chr13:9608274..9608293 59.83 50
upstream ENSMUSE00000414418 Chr13:9609943..9610144 CAGCAAATACCCTTCCCAAA Chr13:9609992..9610011 59.93 45
upstream ENSMUSE00000684757 Chr13:9609943..9610144 CAGCAAATACCCTTCCCAAA Chr13:9609992..9610011 59.93 45
upstream ENSMUSE00000376391 Chr13:9613593..9613702 GGCAGAGACCTGGGTCAGAT Chr13:9613658..9613677 61.62 60
upstream ENSMUSE00000684754 Chr13:9613593..9613714 CCTCAGTGATGGTGGGAAAT Chr13:9613605..9613624 59.78 50
upstream ENSMUSE00000115159 Chr13:9614991..9615071 ACCACTCCTGACCATCTGCT Chr13:9615030..9615049 59.71 55
upstream ENSMUSE00000115148 Chr13:9621125..9621248 ACACAAGCGTGCAGAAAAGA Chr13:9621160..9621179 59.64 45
upstream ENSMUSE00000115136 Chr13:9621828..9621949 CATTGCAACGACATTGCCTA Chr13:9621910..9621929 60.67 45
upstream ENSMUSE00000115144 Chr13:9623003..9623114 GCCCCTCATACTGGACACAG Chr13:9623095..9623114 60.53 60
upstream ENSMUSE00000251652 Chr13:9623204..9623313 GCCTGCCCAGATCTACAAAC Chr13:9623223..9623242 59.7 55
upstream ENSMUSE00000115129 Chr13:9627219..9627349 CAGTGCGAGCTTTACCCTTC Chr13:9627264..9627283 60.01 55

*** Putative Vector Insertion (Chr 13: 9627350 - 9633967) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000115127 Chr13:9633968..9634136 GCTCCATCACCGAATAGGAA Chr13:9634098..9634117 60.04 50
downstream ENSMUSE00000115145 Chr13:9636341..9636511 AAGCAAATTGCCAGGTTCAC Chr13:9636510..9636529 60.12 45
downstream ENSMUSE00000572009 Chr13:9646225..9646286 CATAGACAGTGGTGGGGTCA Chr13:9646261..9646280 59.39 55
downstream ENSMUSE00000115170 Chr13:9653849..9653906 CCCTTTCTACCAACCGGACT Chr13:9653871..9653890 60.35 55
downstream ENSMUSE00000115162 Chr13:9655883..9655957 GGGCCTTTTGTTTCTGGATT Chr13:9655935..9655954 60.3 45
downstream ENSMUSE00000572007 Chr13:9658491..9658665 AGAAAGCCCAGGTAGCCAGT Chr13:9658636..9658655 60.27 55
downstream ENSMUSE00000115153 Chr13:9661383..9661506 TGACACTTTTGTGGGCTCTG Chr13:9661502..9661521 59.87 50
downstream ENSMUSE00000618756 Chr13:9665024..9668171 GTTCCCCAACGGCTAGTACA Chr13:9666835..9666854 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTGACAGCAAGCCCACTT Chr13:9633363..9633383 59.91 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGTGACAGCAAGCCCACTT Chr13:9633363..9633383 59.91 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048264