Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14348
Trapped Gene
Mcm7 (ENSMUSG00000029730)
Vector Insertion
Chr 5: 138606279 - 138607307
Public Clones FHCRC-GT-S18-12A1 (fhcrc)
Private Clones OST403385 (lexicon) OST339835 (lexicon) OST288246 (lexicon) OST265930 (lexicon)
OST259575 (lexicon) OST236814 (lexicon) OST230652 (lexicon) OST218602 (lexicon)
OST210402 (lexicon) OST201889 (lexicon) OST198395 (lexicon) OST169234 (lexicon)
OST127294 (lexicon) OST125225 (lexicon) OST124723 (lexicon)
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000192148 (Chr5:138607138..138607306 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCTCCGACTTTCCACTGCT Chr5:138607141..138607160 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000192148 (Chr5:138607138..138607306 -)
Downstram Exon
ENSMUSE00000192153 (Chr5:138606280..138606389 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCTCCGACTTTCCACTGCT Chr5:138607141..138607160 59.99 50 TCCTTCGACATCTCCATCAA Chr5:138606291..138606310 59.17 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000686007 Chr5:138612954..138613090 GATGGCGCTTAAGGACTACG Chr5:138612966..138612985 59.87 55
upstream ENSMUSE00000304321 Chr5:138611545..138611624 No primer for this exon
upstream ENSMUSE00000192143 Chr5:138610788..138610952 GCCAAGCGCTACTCAAGACT Chr5:138610837..138610856 59.79 55
upstream ENSMUSE00000192142 Chr5:138610577..138610701 CCCCCAAAACCAGTATCCTT Chr5:138610596..138610615 60.05 50
upstream ENSMUSE00000192155 Chr5:138610326..138610506 CGGGAAGTACGAGCTGACTC Chr5:138610441..138610460 60.01 60
upstream ENSMUSE00000304275 Chr5:138610038..138610175 ACAGACTCGTGGCTCCAAAT Chr5:138610073..138610092 59.73 50
upstream ENSMUSE00000192141 Chr5:138609561..138609710 AGCGTCACTGGCATCTTCTT Chr5:138609598..138609617 60.02 50
upstream ENSMUSE00000192152 Chr5:138609286..138609400 GCCCACTGGATTGTGAAGAT Chr5:138609354..138609373 59.93 50
upstream ENSMUSE00000192150 Chr5:138609069..138609200 GTGGTGTGGACCAGTCTCCT Chr5:138609088..138609107 60.01 60
upstream ENSMUSE00000192151 Chr5:138608779..138608862 GTGTGGCCAAATCTCAGCTC Chr5:138608810..138608829 60.81 55
upstream ENSMUSE00000192145 Chr5:138608274..138608667 GGATTCTCACCACGCTCAAT Chr5:138608432..138608451 60.08 50
upstream ENSMUSE00000192147 Chr5:138607911..138607994 TCACCTATGTCCACCAGCAC Chr5:138607961..138607980 59.55 55
upstream ENSMUSE00000192148 Chr5:138607138..138607306 TTCTCCGACTTTCCACTGCT Chr5:138607141..138607160 59.99 50
upstream ENSMUSE00000192153 Chr5:138606280..138606389 GCTCGACTTCGGATGGTAGA Chr5:138606370..138606389 60.36 55

*** Putative Vector Insertion (Chr 5: 138606279 - 138607307) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000535291 Chr5:138605817..138606148 TGAAGCCACGAGATATGCAG Chr5:138606017..138606036 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGACTTTCCACTGCTCTGGT Chr5:138607134..138607154 60.44 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGACTTTCCACTGCTCTGGT Chr5:138607134..138607154 60.44 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029730