Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14352
Trapped Gene
Chst5 (ENSMUSG00000031952)
Vector Insertion
Chr 8: 114413035 - 114434100
Public Clones FHCRC-GT-S17-9H1 (fhcrc) IST14948A6 (tigm) IST14790A5 (tigm) IST12617G5 (tigm)
IST10245D3 (tigm) IST11782E9 (tigm) IST12467D7 (tigm) IST13077D1 (tigm)
IST14845C2 (tigm) IST13061F3 (tigm) IST10245D3 (tigm) IST13200C3 (tigm)
IST14569D10 (tigm) IST14928G8 (tigm) IST14984F3 (tigm) IST12089C4 (tigm)
IST14628E8 (tigm) IST14785D8 (tigm) IST14948A6 (tigm) IST12467D7 (tigm)
IST14319C10 (tigm) IST13604B1 (tigm) IST11445B11 (tigm) IST13283C8 (tigm)
IST14655B5 (tigm) IST10295E9 (tigm) IST12706B12BBF1 (tigm) IST12694B9 (tigm)
IST13030D3 (tigm) IST13604B1 (tigm) IST14818E2 (tigm) IST12328A1 (tigm)
IST14791A8 (tigm) IST12157E6 (tigm) IST10295E9 (tigm) IST14984F3 (tigm)
IST14845C2 (tigm) IST14508E3 (tigm) IST13417A8 (tigm) IST12784A5 (tigm)
IST14928G8 (tigm)
Private Clones OST311256 (lexicon) OST285488 (lexicon) OST104737 (lexicon) OST74806 (lexicon)
OST45601 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000342669 (Chr8:114434032..114434099 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACTGAGCGGCTCTTTGTGT Chr8:114434074..114434093 60.6 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000342669 (Chr8:114434032..114434099 -)
Downstram Exon
ENSMUSE00000214926 (Chr8:114413036..114414901 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACTGAGCGGCTCTTTGTGT Chr8:114434074..114434093 60.6 55 AGGAGCGAAAGCATGACAGT Chr8:114414821..114414840 60.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000342669 Chr8:114434032..114434099 GACTGAGCGGCTCTTTGTGT Chr8:114434074..114434093 60.6 55
upstream ENSMUSE00000214926 Chr8:114413036..114414901 ACTGTCATGCTTTCGCTCCT Chr8:114414843..114414862 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTGAGGAGGATGGCTTTT Chr8:114419108..114419128 60.07 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTGAGGAGGATGGCTTTT Chr8:114419108..114419128 60.07 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTGTAATCGCCTTGCAGCAC Chr8:114418963..114418983 61.78 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCACTCTACTGTGTCCCTCGTG Chr8:114418976..114418998 60.36 54.54 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031952