Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14360
Trapped Gene
Vps54 (ENSMUSG00000020128)
Vector Insertion
Chr 11: 21205784 - 21206368
Public Clones FHCRC-GT-S16-9D1 (fhcrc)
Private Clones not available
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000101005 (Chr11:21205654..21205783 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000101005 (Chr11:21205654..21205783 +)
Downstram Exon
ENSMUSE00000100991 (Chr11:21206369..21206550 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486749 Chr11:21139284..21139374 No primer for this exon
upstream ENSMUSE00000101001 Chr11:21163202..21163357 No primer for this exon
upstream ENSMUSE00000720987 Chr11:21163202..21163357 No primer for this exon
upstream ENSMUSE00000101029 Chr11:21164633..21164874 No primer for this exon
upstream ENSMUSE00000680799 Chr11:21164669..21164874 No primer for this exon
upstream ENSMUSE00000100994 Chr11:21168788..21168866 No primer for this exon
upstream ENSMUSE00000100993 Chr11:21171707..21171741 No primer for this exon
upstream ENSMUSE00000101000 Chr11:21175001..21175132 No primer for this exon
upstream ENSMUSE00000101031 Chr11:21177678..21178063 No primer for this exon
upstream ENSMUSE00000101013 Chr11:21191036..21191162 No primer for this exon
upstream ENSMUSE00000100987 Chr11:21192027..21192134 No primer for this exon
upstream ENSMUSE00000101023 Chr11:21195344..21195399 No primer for this exon
upstream ENSMUSE00000101036 Chr11:21198757..21198853 No primer for this exon
upstream ENSMUSE00000101016 Chr11:21199981..21200321 No primer for this exon
upstream ENSMUSE00000101005 Chr11:21205654..21205783 No primer for this exon

*** Putative Vector Insertion (Chr 11: 21205784 - 21206368) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000100991 Chr11:21206369..21206550 No primer for this exon
downstream ENSMUSE00000100990 Chr11:21206912..21207024 No primer for this exon
downstream ENSMUSE00000100995 Chr11:21208742..21208805 No primer for this exon
downstream ENSMUSE00000100996 Chr11:21211080..21211185 No primer for this exon
downstream ENSMUSE00000100989 Chr11:21212243..21212330 No primer for this exon
downstream ENSMUSE00000461465 Chr11:21212854..21212975 No primer for this exon
downstream ENSMUSE00000101022 Chr11:21213087..21213167 No primer for this exon
downstream ENSMUSE00000101017 Chr11:21214922..21215029 No primer for this exon
downstream ENSMUSE00000101020 Chr11:21216795..21216889 No primer for this exon
downstream ENSMUSE00000383441 Chr11:21219756..21221136 No primer for this exon
downstream ENSMUSE00000655282 Chr11:21219756..21221125 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr11:21205834..21205854 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAGTGTCGTGACTGGGAAAA Chr11:21205828..21205849 59.62 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020128