Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14364
Trapped Gene
Slc25a12 (ENSMUSG00000027010)
Vector Insertion
Chr 2: 71181946 - 71204638
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) FHCRC-GT-S16-7A1 (fhcrc) PST24854-NR (escells)
IST13779B5 (tigm) IST14168E1 (tigm) IST15045H8 (tigm) IST13980E3 (tigm)
IST10806C3 (tigm) IST14420E12 (tigm) IST14771A4 (tigm) IST14433A8 (tigm)
IST10973E1 (tigm) IST14073E1 (tigm) IST10578A5 (tigm) IST14615B11 (tigm)
IST10222E12 (tigm) IST14467B9 (tigm) IST10246A10 (tigm) IST14446A4 (tigm)
IST10012B11 (tigm) IST12029F11 (tigm) IST10042G5 (tigm) IST13228E2 (tigm)
IST10260D7 (tigm) IST12450G1 (tigm) IST12843G11 (tigm) IST10396A11 (tigm)
IST14954B7 (tigm) IST14485A3 (tigm) IST10396A11 (tigm) IST12467E10 (tigm)
IST13810B7 (tigm) IST10878G3 (tigm) IST12795C1 (tigm) IST14215E11 (tigm)
IST12412C11 (tigm) IST13619D11 (tigm) IST13432H3 (tigm) IST12085E10 (tigm)
IST14482G8 (tigm) IST10542E8 (tigm) IST12450G1 (tigm) IST14684F10 (tigm)
IST13835F8 (tigm) IST12024H9 (tigm) IST10212A6 (tigm) IST15044A5 (tigm)
IST15103G7 (tigm) IST14684F10 (tigm) IST15045B12 (tigm) IST13402H7 (tigm)
IST12593D11 (tigm) IST14966G10 (tigm) IST13077E11 (tigm) IST14394D11 (tigm)
IST13684E2 (tigm) IST14588C2 (tigm) IST11835G8 (tigm) IST14426H3 (tigm)
IST13539G7 (tigm) IST11329D9 (tigm) IST14465H12 (tigm) IST13558C11 (tigm)
IST13964H7 (tigm) IST14215F11 (tigm) IST13407C11 (tigm) IST10931C7 (tigm)
IST13173B1 (tigm) IST13945D1 (tigm) IST13102F8 (tigm) IST13249H11 (tigm)
IST14497A4 (tigm) IST10821A7 (tigm) IST14464D8 (tigm) IST14524B3 (tigm)
IST14457H11 (tigm) IST14308A5 (tigm) IST13923H4 (tigm) IST13173B1 (tigm)
IST13447H11 (tigm) IST13549C1 (tigm) IST11835F8 (tigm) IST10042G5 (tigm)
IST14478A10 (tigm) IST14426H3 (tigm) IST10373D9 (tigm) IST13251D11 (tigm)
IST13688D2 (tigm) IST11500H3 (tigm) IST14343A5 (tigm) IST10586D10 (tigm)
IST14497A4 (tigm) IST10050F8 (tigm) IST14466B3 (tigm) IST15103G7 (tigm)
IST13102F8 (tigm) IST14482G8 (tigm) IST12593D11 (tigm) IST14394G8 (tigm)
IST13711H1 (tigm) IST14457H11 (tigm) IST13684E2 (tigm) IST11781F8 (tigm)
IST13666D9 (tigm) IST14209H8 (tigm) IST11766E12 (tigm) IST13779B5 (tigm)
IST11922B4 (tigm) IST13888D3 (tigm) IST12965E6 (tigm) IST14954B7 (tigm)
IST13835F8 (tigm) IST10975H2 (tigm) IST14394D11 (tigm) IST14791E2 (tigm)
IST14444H3 (tigm) IST15044A5 (tigm) IST10434B4 (tigm) IST12314H4 (tigm)
IST13077E11 (tigm) IST14446A4 (tigm) IST13512E2 (tigm) IST10482G8 (tigm)
IST14143F12 (tigm) IST13520H12 (tigm) IST15058E1 (tigm) IST12789C11 (tigm)
IST11766E12 (tigm) IST14177A8 (tigm) IST12757D3 (tigm) IST12055A3 (tigm)
Private Clones OST439515 (lexicon) OST358635 (lexicon) OST338573 (lexicon) OST329211 (lexicon)
OST313248 (lexicon) OST296343 (lexicon) OST242521 (lexicon) OST213674 (lexicon)
OST209087 (lexicon) OST171038 (lexicon) OST104597 (lexicon) OST92670 (lexicon)
OST92348 (lexicon) OST90458 (lexicon) OST67546 (lexicon) OST57656 (lexicon)
OST55771 (lexicon) OST54773 (lexicon) OST34459 (lexicon) OST33770 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662333 (Chr2:71204584..71204637 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAACCAAACGAGGTGATCCT Chr2:71204611..71204630 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662333 (Chr2:71204584..71204637 -)
Downstram Exon
ENSMUSE00000662332 (Chr2:71181947..71182089 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAACCAAACGAGGTGATCCT Chr2:71204611..71204630 59.97 50 GGATCGTTGTACAGGCCAAG Chr2:71181985..71182004 60.52 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662334 Chr2:71205570..71205640 No primer for this exon
upstream ENSMUSE00000662333 Chr2:71204584..71204637 CAACCAAACGAGGTGATCCT Chr2:71204611..71204630 59.97 50
upstream ENSMUSE00000662332 Chr2:71181947..71182089 ACCCAAAGATTGTGCAGCTC Chr2:71181979..71181998 60.26 50

*** Putative Vector Insertion (Chr 2: 71181946 - 71204638) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000320612 Chr2:71171662..71171777 TCTCCATTTCCGCTCTTGTC Chr2:71171651..71171670 60.34 50
downstream ENSMUSE00000165429 Chr2:71162033..71162172 TCTGCCCAAAAATCTCCTTG Chr2:71162124..71162143 60.18 45
downstream ENSMUSE00000165435 Chr2:71153040..71153186 GAAATCCAGACCCGAGATCA Chr2:71153084..71153103 60.01 50
downstream ENSMUSE00000566456 Chr2:71150482..71150620 TATCTTTCCTCGTGCCTGCT Chr2:71150475..71150494 59.98 50
downstream ENSMUSE00000165430 Chr2:71149520..71149613 No primer for this exon
downstream ENSMUSE00000320519 Chr2:71146113..71146197 GCGGAGCTATTCTCTCGATG Chr2:71146138..71146157 60.08 55
downstream ENSMUSE00000320512 Chr2:71136627..71136708 CTGGAGCCAGATAGGTCTGC Chr2:71136651..71136670 59.97 60
downstream ENSMUSE00000566451 Chr2:71134722..71134880 TCCAAAGAAACCCTCGTAGC Chr2:71134710..71134729 59.31 50
downstream ENSMUSE00000165434 Chr2:71131729..71131781 TTTCTGGTGCAACCCCTATC Chr2:71131724..71131743 59.93 50
downstream ENSMUSE00000165424 Chr2:71131417..71131497 GCAACCTCCAGCAAGGATTT Chr2:71131395..71131414 61.51 50
downstream ENSMUSE00000566446 Chr2:71120527..71120667 CCTGAAGCACATTCAGAGCA Chr2:71120531..71120550 60.14 50
downstream ENSMUSE00000165433 Chr2:71117573..71117711 GTGAGCGTACACGGGAAAAT Chr2:71117624..71117643 60 50
downstream ENSMUSE00000165428 Chr2:71114698..71114856 CCTTCTTCCCGGAGAATCTT Chr2:71114705..71114724 59.65 50
downstream ENSMUSE00000566445 Chr2:71114489..71114579 GAGGTGAGGATCGAAACACC Chr2:71114534..71114553 59.51 55
downstream ENSMUSE00000662331 Chr2:71112803..71113410 CCTGGGCGTATGATCACTTT Chr2:71113052..71113071 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr2:71183570..71183590 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTGTTTCTCTCTGGGAACTT Chr2:71183620..71183642 60.15 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTTTTCCTCCTGCTGTCCTG Chr2:71183578..71183598 60.37 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTCTCGTGACTGGGAAAACC Chr2:71183516..71183536 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027010