Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14367
Trapped Gene
Lass2 (ENSMUSG00000015714)
Vector Insertion
Chr 3: 95119268 - 95123983
Public Clones D088D02 (ggtc) 5SE167E04 (ggtc) D088D02 (ggtc) (ggtc) FHCRC-GT-S16-4B1 (fhcrc)
IST14380E4 (tigm) IST14827F1 (tigm) IST12982D2 (tigm) IST13203F4 (tigm)
IST14491E4 (tigm) IST12838F9 (tigm) IST12529D6 (tigm) IST12529D6 (tigm)
IST14379C7 (tigm)
Private Clones OST451850 (lexicon) OST423450 (lexicon) OST295263 (lexicon) OST285172 (lexicon)
OST237941 (lexicon) OST158795 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000253068 (Chr3:95119189..95119267 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000253068 (Chr3:95119189..95119267 +)
Downstram Exon
ENSMUSE00000253063 (Chr3:95123984..95124157 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000253068 Chr3:95119189..95119267 No primer for this exon

*** Putative Vector Insertion (Chr 3: 95119268 - 95123983) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000253063 Chr3:95123984..95124157 No primer for this exon
downstream ENSMUSE00000253057 Chr3:95124564..95124681 No primer for this exon
downstream ENSMUSE00000253053 Chr3:95124864..95124982 No primer for this exon
downstream ENSMUSE00000253049 Chr3:95125112..95125169 No primer for this exon
downstream ENSMUSE00000253042 Chr3:95125258..95125308 No primer for this exon
downstream ENSMUSE00000176414 Chr3:95125497..95125589 No primer for this exon
downstream ENSMUSE00000176412 Chr3:95125753..95125881 No primer for this exon
downstream ENSMUSE00000176408 Chr3:95126049..95126155 No primer for this exon
downstream ENSMUSE00000176410 Chr3:95126242..95126395 No primer for this exon
downstream ENSMUSE00000362790 Chr3:95126571..95127488 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGACGCCGAGTAAGTCTGT Chr3:95119259..95119279 62.69 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGACGCCGAGTAAGTCTGT Chr3:95119259..95119279 62.69 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015714