Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14369
Trapped Gene
Thoc7 (ENSMUSG00000053453)
Vector Insertion
Chr 14: 14787052 - 14793752
Public Clones FHCRC-GT-S16-3E1 (fhcrc)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000692562 (Chr14:14793699..14793751 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000692562 (Chr14:14793699..14793751 -)
Downstram Exon
ENSMUSE00000517611 (Chr14:14787053..14787170 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGATCCAGAGTTGCACCATT Chr14:14787042..14787061 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692562 Chr14:14793699..14793751 No primer for this exon
upstream ENSMUSE00000517611 Chr14:14787053..14787170 TGGGGATGATCGGAGAATTA Chr14:14787108..14787127 60.23 45

*** Putative Vector Insertion (Chr 14: 14787052 - 14793752) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000456995 Chr14:14785929..14786052 CTCAGCATGCGTTGGTACTG Chr14:14786004..14786023 60.47 55
downstream ENSMUSE00000294008 Chr14:14785590..14785680 TCGTATTCGTTTTGCTTGAAGA Chr14:14785581..14785602 59.89 36.36
downstream ENSMUSE00000294000 Chr14:14783720..14783777 No primer for this exon
downstream ENSMUSE00000120423 Chr14:14782813..14782879 No primer for this exon
downstream ENSMUSE00000120427 Chr14:14782646..14782715 TTGTTTCCGTCTCAATTCCA Chr14:14782673..14782692 59.1 40
downstream ENSMUSE00000650896 Chr14:14781528..14781841 GCGACGGTCAGTCCATCTAT Chr14:14781736..14781755 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACTGGCTCTCAGAAAGGATG Chr14:14787764..14787785 60 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTTTTCGTGACTGGGAAA Chr14:14787688..14787708 60.6 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053453