Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14371
Trapped Gene
Scn3a (ENSMUSG00000057182)
Vector Insertion
Chr 2: 65374469 - 65405552
Public Clones FHCRC-GT-S16-2C1 (fhcrc) IST11244D8 (tigm) IST11071G1 (tigm) IST14244F8 (tigm)
IST12137B3 (tigm)
Private Clones OST311239 (lexicon) OST52130 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000691631 (Chr2:65405323..65405551 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTGTCCTTTGTTGAGCTG Chr2:65405346..65405365 60.17 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000691631 (Chr2:65405323..65405551 -)
Downstram Exon
ENSMUSE00000710041 (Chr2:65374470..65374783 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTGTCCTTTGTTGAGCTG Chr2:65405346..65405365 60.17 50 CTTCCCAGCTTCCAAGTCAC Chr2:65374535..65374554 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000691596 Chr2:65405323..65405684 TGCTGTCCTTTGTTGAGCTG Chr2:65405346..65405365 60.17 50
upstream ENSMUSE00000691631 Chr2:65405323..65405551 TGCTGTCCTTTGTTGAGCTG Chr2:65405346..65405365 60.17 50
upstream ENSMUSE00000710041 Chr2:65374470..65374783 CCTGGACCCCTACTACGTCA Chr2:65374478..65374497 59.98 60
upstream ENSMUSE00000713959 Chr2:65374470..65374783 CCTGGACCCCTACTACGTCA Chr2:65374478..65374497 59.98 60
upstream ENSMUSE00000721121 Chr2:65374470..65374783 CCTGGACCCCTACTACGTCA Chr2:65374478..65374497 59.98 60

*** Putative Vector Insertion (Chr 2: 65374469 - 65405552) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000566691 Chr2:65368861..65368979 TCCTAACGGGGTTTAGTGGA Chr2:65368867..65368886 59.42 50
downstream ENSMUSE00000691592 Chr2:65368861..65368979 TCCTAACGGGGTTTAGTGGA Chr2:65368867..65368886 59.42 50
downstream ENSMUSE00000691629 Chr2:65368860..65368979 TCCTAACGGGGTTTAGTGGA Chr2:65368867..65368886 59.42 50
downstream ENSMUSE00000496069 Chr2:65367447..65367536 CATTCTTCGTCCAGTCAGGAG Chr2:65367429..65367449 59.85 52.38
downstream ENSMUSE00000691590 Chr2:65367447..65367536 CATTCTTCGTCCAGTCAGGAG Chr2:65367429..65367449 59.85 52.38
downstream ENSMUSE00000691627 Chr2:65367447..65367535 CATTCTTCGTCCAGTCAGGAG Chr2:65367429..65367449 59.85 52.38
downstream ENSMUSE00000602458 Chr2:65364554..65364682 AGTTCCATGGGTCACGAAGA Chr2:65364560..65364579 60.51 50
downstream ENSMUSE00000691569 Chr2:65364554..65364684 TCCATGGGTCACGAAGAAAT Chr2:65364563..65364582 60.32 45
downstream ENSMUSE00000691583 Chr2:65364554..65364682 AGTTCCATGGGTCACGAAGA Chr2:65364560..65364579 60.51 50
downstream ENSMUSE00000691568 Chr2:65363934..65364025 AGAGCTCGCAAGACTCTGAAA Chr2:65363935..65363955 59.51 47.62
downstream ENSMUSE00000602457 Chr2:65363752..65363843 TTGTTTTCAATGCTCGGAGA Chr2:65363745..65363764 59.4 40
downstream ENSMUSE00000691582 Chr2:65363752..65363843 TTGTTTTCAATGCTCGGAGA Chr2:65363745..65363764 59.4 40
downstream ENSMUSE00000356142 Chr2:65362661..65362933 TGAGAGCAAAGACGCTCAGA Chr2:65362816..65362835 60.01 50
downstream ENSMUSE00000711582 Chr2:65362661..65362933 TGAGAGCAAAGACGCTCAGA Chr2:65362816..65362835 60.01 50
downstream ENSMUSE00000719364 Chr2:65362661..65362933 TGAGAGCAAAGACGCTCAGA Chr2:65362816..65362835 60.01 50
downstream ENSMUSE00000381484 Chr2:65362203..65362266 CGGACCCATTTCCACAAAGT Chr2:65362188..65362207 62.06 50
downstream ENSMUSE00000691581 Chr2:65362203..65362266 CGGACCCATTTCCACAAAGT Chr2:65362188..65362207 62.06 50
downstream ENSMUSE00000371666 Chr2:65359849..65359990 TAACCGTAGTTGGGGTTTCG Chr2:65359912..65359931 59.85 50
downstream ENSMUSE00000691580 Chr2:65359849..65359990 TAACCGTAGTTGGGGTTTCG Chr2:65359912..65359931 59.85 50
downstream ENSMUSE00000549937 Chr2:65358880..65359086 CTCCAGTGTGGCCTGATTTT Chr2:65358930..65358949 60.11 50
downstream ENSMUSE00000691624 Chr2:65358880..65359086 CTCCAGTGTGGCCTGATTTT Chr2:65358930..65358949 60.11 50
downstream ENSMUSE00000644949 Chr2:65352529..65352819 TCCAAGTGCTCCCTCTGTCT Chr2:65352640..65352659 59.99 55
downstream ENSMUSE00000644950 Chr2:65352529..65352819 TCCAAGTGCTCCCTCTGTCT Chr2:65352640..65352659 59.99 55
downstream ENSMUSE00000691588 Chr2:65346519..65346719 TATTGCGTCTTGGGGAAAAC Chr2:65346652..65346671 59.94 45
downstream ENSMUSE00000691578 Chr2:65346342..65346719 TATTGCGTCTTGGGGAAAAC Chr2:65346652..65346671 59.94 45
downstream ENSMUSE00000602379 Chr2:65346339..65346719 TATTGCGTCTTGGGGAAAAC Chr2:65346652..65346671 59.94 45
downstream ENSMUSE00000691565 Chr2:65346334..65346719 TATTGCGTCTTGGGGAAAAC Chr2:65346652..65346671 59.94 45
downstream ENSMUSE00000602454 Chr2:65345204..65345336 ATGGCTCTTTGTCTCCCAGA Chr2:65345217..65345236 59.8 50
downstream ENSMUSE00000691577 Chr2:65345204..65345339 ATGGCTCTTTGTCTCCCAGA Chr2:65345217..65345236 59.8 50
downstream ENSMUSE00000602453 Chr2:65344074..65344312 GTCATCGGGTAGTGCTCCAT Chr2:65344089..65344108 59.96 55
downstream ENSMUSE00000691621 Chr2:65344074..65344312 GTCATCGGGTAGTGCTCCAT Chr2:65344089..65344108 59.96 55
downstream ENSMUSE00000602452 Chr2:65336924..65337097 GGATCCATTGCGATGATTTT Chr2:65337020..65337039 59.73 40
downstream ENSMUSE00000691576 Chr2:65336924..65337097 GGATCCATTGCGATGATTTT Chr2:65337020..65337039 59.73 40
downstream ENSMUSE00000602451 Chr2:65335427..65335783 ACCACGGCAAAAATGAAGAC Chr2:65335631..65335650 59.98 45
downstream ENSMUSE00000691573 Chr2:65335427..65335783 ACCACGGCAAAAATGAAGAC Chr2:65335631..65335650 59.98 45
downstream ENSMUSE00000602450 Chr2:65332980..65333453 TTGTTCCCTTCGTGGATTTC Chr2:65333223..65333242 59.91 45
downstream ENSMUSE00000428905 Chr2:65332950..65333453 TTGTTCCCTTCGTGGATTTC Chr2:65333223..65333242 59.91 45
downstream ENSMUSE00000644951 Chr2:65332898..65332948 No primer for this exon
downstream ENSMUSE00000691614 Chr2:65322403..65322523 CTGGCTTAAGGTCCTCCTCA Chr2:65322399..65322418 59.42 55
downstream ENSMUSE00000691612 Chr2:65321100..65321254 CACAATGAACGTCTCAAACCA Chr2:65321108..65321128 59.6 42.86
downstream ENSMUSE00000691610 Chr2:65320208..65320381 GGTCTTCCGTTGCTCAATGT Chr2:65320324..65320343 60.12 50
downstream ENSMUSE00000691609 Chr2:65310336..65310458 CTCAGGGTCCGTAGGGATTT Chr2:65310360..65310379 60.32 55
downstream ENSMUSE00000691607 Chr2:65307983..65308255 AGCCTGACAGTCGCTGAAAT Chr2:65308042..65308061 60.02 50
downstream ENSMUSE00000691604 Chr2:65307069..65307122 ATCCATCCAGCCTTTGAATG Chr2:65307077..65307096 59.89 45
downstream ENSMUSE00000467523 Chr2:65306124..65306261 TGATGACGCCGATGAATAGA Chr2:65306131..65306150 60.18 45
downstream ENSMUSE00000644955 Chr2:65304979..65305083 TTTTGGAGCCAAGTTTCTTCA Chr2:65304986..65305006 59.85 38.1
downstream ENSMUSE00000602442 Chr2:65302772..65303042 GTTCCAGCCAATCGTGAAGT Chr2:65302787..65302806 60.12 50
downstream ENSMUSE00000644954 Chr2:65297922..65299794 TCAGGAGGTGCACTGTTGAG Chr2:65299406..65299425 60.02 55
downstream ENSMUSE00000691587 Chr2:65296320..65299794 TCAGGAGGTGCACTGTTGAG Chr2:65299406..65299425 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCATGACGTTCAAAACCAT Chr2:65387569..65387589 60.76 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGGGAGGATTCACAGAGG Chr2:65402522..65402542 60.19 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGCAAGACATGTCAAGGGCTA Chr2:65387288..65387309 59.89 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTTGGGCTGATGAAGAATCC Chr2:65375270..65375290 59.63 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057182