Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14380
Trapped Gene
Mtap1b (ENSMUSG00000052727)
Vector Insertion
Chr 13: 100214168 - 100278165
Public Clones FHCRC-GT-S16-10A1_A10 (fhcrc)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000519850 (Chr13:100278063..100278164 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAACTTGGACCAGGAACTC Chr13:100278112..100278131 59.7 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000519850 (Chr13:100278063..100278164 -)
Downstram Exon
ENSMUSE00000511825 (Chr13:100214169..100214251 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAACTTGGACCAGGAACTC Chr13:100278112..100278131 59.7 55 CGTCACTTCGGTGATGAAGA Chr13:100214200..100214219 59.83 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000514152 Chr13:100286259..100286495 GAGACCGTAACCGAAGAGCA Chr13:100286291..100286310 60.4 55
upstream ENSMUSE00000519850 Chr13:100278063..100278164 GCAACTTGGACCAGGAACTC Chr13:100278112..100278131 59.7 55
upstream ENSMUSE00000511825 Chr13:100214169..100214251 TCGTTCTGATCAACCCTTCA Chr13:100214190..100214209 59.22 45

*** Putative Vector Insertion (Chr 13: 100214168 - 100278165) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000471664 Chr13:100211589..100211729 TGAGCACCAGCAGTTTATGG Chr13:100211659..100211678 59.86 50
downstream ENSMUSE00000510765 Chr13:100199167..100205656 GACACGTCATCTGTGGTTGG Chr13:100201445..100201464 60.01 55
downstream ENSMUSE00000498887 Chr13:100197174..100197412 GTGGACGACTTGGCTGTCTT Chr13:100197357..100197376 60.31 55
downstream ENSMUSE00000504699 Chr13:100194396..100195916 GGCTGCGGTCTCTACAGTTC Chr13:100195728..100195747 60.02 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATGAACCAAAAACGATGGA Chr13:100245167..100245188 59.31 33.33 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAATGAACCAAAAACGATGGA Chr13:100245167..100245188 59.31 33.33 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052727