Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14388
Trapped Gene
Tex14 (ENSMUSG00000010342)
Vector Insertion
Chr 11: 87247448 - 87287905
Public Clones FHCRC-GT-S15-7B1 (fhcrc) IST13211E3 (tigm) IST14927H8 (tigm) IST13566F11 (tigm)
IST12668B3 (tigm) IST14786D9 (tigm) IST11310A10 (tigm)
Private Clones OST56355 (lexicon) OST35786 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000475040 (Chr11:87247312..87247447 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000475040 (Chr11:87247312..87247447 +)
Downstram Exon
ENSMUSE00000379158 (Chr11:87287906..87288020 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000675049 Chr11:87218567..87218672 No primer for this exon
upstream ENSMUSE00000336125 Chr11:87247311..87247447 No primer for this exon
upstream ENSMUSE00000475040 Chr11:87247312..87247447 No primer for this exon

*** Putative Vector Insertion (Chr 11: 87247448 - 87287905) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000379158 Chr11:87287906..87288020 No primer for this exon
downstream ENSMUSE00000675056 Chr11:87298202..87298367 No primer for this exon
downstream ENSMUSE00000457623 Chr11:87299751..87299887 No primer for this exon
downstream ENSMUSE00000649285 Chr11:87299771..87299887 No primer for this exon
downstream ENSMUSE00000105359 Chr11:87306542..87306623 No primer for this exon
downstream ENSMUSE00000649284 Chr11:87306542..87306623 No primer for this exon
downstream ENSMUSE00000457620 Chr11:87308454..87308584 No primer for this exon
downstream ENSMUSE00000649283 Chr11:87308454..87308584 No primer for this exon
downstream ENSMUSE00000105368 Chr11:87309702..87309815 No primer for this exon
downstream ENSMUSE00000675048 Chr11:87309702..87309815 No primer for this exon
downstream ENSMUSE00000268288 Chr11:87311332..87311455 No primer for this exon
downstream ENSMUSE00000675047 Chr11:87311332..87311455 No primer for this exon
downstream ENSMUSE00000268279 Chr11:87312986..87313164 No primer for this exon
downstream ENSMUSE00000675046 Chr11:87312986..87313164 No primer for this exon
downstream ENSMUSE00000105351 Chr11:87323070..87323221 No primer for this exon
downstream ENSMUSE00000675045 Chr11:87323070..87323221 No primer for this exon
downstream ENSMUSE00000105374 Chr11:87324927..87325117 No primer for this exon
downstream ENSMUSE00000675044 Chr11:87324927..87325117 No primer for this exon
downstream ENSMUSE00000105350 Chr11:87325635..87325785 No primer for this exon
downstream ENSMUSE00000675043 Chr11:87325635..87325785 No primer for this exon
downstream ENSMUSE00000105363 Chr11:87327444..87328363 No primer for this exon
downstream ENSMUSE00000675042 Chr11:87327444..87328363 No primer for this exon
downstream ENSMUSE00000586398 Chr11:87330170..87330276 No primer for this exon
downstream ENSMUSE00000675041 Chr11:87330170..87330276 No primer for this exon
downstream ENSMUSE00000586397 Chr11:87333157..87333239 No primer for this exon
downstream ENSMUSE00000675040 Chr11:87333157..87333239 No primer for this exon
downstream ENSMUSE00000586396 Chr11:87334140..87334421 No primer for this exon
downstream ENSMUSE00000675039 Chr11:87334140..87334421 No primer for this exon
downstream ENSMUSE00000105361 Chr11:87335997..87336097 No primer for this exon
downstream ENSMUSE00000105349 Chr11:87341346..87341412 No primer for this exon
downstream ENSMUSE00000105379 Chr11:87345849..87345930 No primer for this exon
downstream ENSMUSE00000105364 Chr11:87347041..87347103 No primer for this exon
downstream ENSMUSE00000105370 Chr11:87349035..87349162 No primer for this exon
downstream ENSMUSE00000105358 Chr11:87350197..87350402 No primer for this exon
downstream ENSMUSE00000105353 Chr11:87352068..87352164 No primer for this exon
downstream ENSMUSE00000105352 Chr11:87352498..87352572 No primer for this exon
downstream ENSMUSE00000649249 Chr11:87352506..87352572 No primer for this exon
downstream ENSMUSE00000105373 Chr11:87355992..87356069 No primer for this exon
downstream ENSMUSE00000105366 Chr11:87356786..87356879 No primer for this exon
downstream ENSMUSE00000105367 Chr11:87362934..87363026 No primer for this exon
downstream ENSMUSE00000105378 Chr11:87365033..87365142 No primer for this exon
downstream ENSMUSE00000105377 Chr11:87368430..87368481 No primer for this exon
downstream ENSMUSE00000339599 Chr11:87368986..87369324 No primer for this exon
downstream ENSMUSE00000649255 Chr11:87368986..87369325 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCGATTGGCTGTTCGTAAT Chr11:87280483..87280503 60.47 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGCATGTCTCACCATCACC Chr11:87271425..87271445 59.35 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000010342