Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14400
Trapped Gene
Dpy30 (ENSMUSG00000024067)
Vector Insertion
Chr 17: 74707059 - 74715290
Public Clones (sanger) P106D10 (ggtc) (ggtc) H007C02 (ggtc) (ggtc)
E044G11 (ggtc) (ggtc) CMHD-GT_387F4-3 (cmhd) CMHD-GT_533C1-5S (cmhd) FHCRC-GT-S14-9C1 (fhcrc)
PST21934-NL (escells) PST17295-NR (escells) PST23095-NR (escells) PST26849-NR (escells)
PST17391-NR (escells) IST12917D2 (tigm) IST10012A8 (tigm)
Private Clones OST335975 (lexicon) OST166765 (lexicon) OST87813 (lexicon) OST56721 (lexicon)
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000137924 (Chr17:74715242..74715289 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAGTACGGGCTCACAGACA Chr17:74715250..74715269 60.46 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000137924 (Chr17:74715242..74715289 -)
Downstram Exon
ENSMUSE00000137928 (Chr17:74707060..74707202 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAGTACGGGCTCACAGACA Chr17:74715250..74715269 60.46 55 TCCACCTTCTGTTTCGATGA Chr17:74707125..74707144 59.22 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692284 Chr17:74715685..74715761 GGGCACTTAGGAACCGACAG Chr17:74715696..74715715 61.96 60
upstream ENSMUSE00000137925 Chr17:74715384..74715456 ACTGGTATCCGGTTGATTGC Chr17:74715437..74715456 59.82 50
upstream ENSMUSE00000137924 Chr17:74715242..74715289 TGAGTACGGGCTCACAGACA Chr17:74715250..74715269 60.46 55
upstream ENSMUSE00000137928 Chr17:74707060..74707202 TCATCGAAACAGAAGGTGGA Chr17:74707147..74707166 59.22 45

*** Putative Vector Insertion (Chr 17: 74707059 - 74715290) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000692277 Chr17:74698821..74699164 ATCTTCAAACTGCGCCTTGT Chr17:74699079..74699098 59.88 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTAGCAGTTTGTGCATGG Chr17:74715243..74715263 59.49 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTAGCAGTTTGTGCATGG Chr17:74715243..74715263 59.49 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGAGTACGGGCTCACAGACA Chr17:74709248..74709268 60.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCTCTTGAGAGCCGTGACTG Chr17:74715182..74715202 59.28 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024067