Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14402
Trapped Gene
Csnk1e (ENSMUSG00000022433)
Vector Insertion
Chr 15: 79260484 - 79269286
Public Clones (sanger) D056B01 (ggtc) D068F02 (ggtc) FHCRC-GT-S14-8H1 (fhcrc) PST316-1 (escells)
PST838-1 (escells) PST89-1 (escells) PST1730-2 (escells) PST1418-1 (escells)
PST713-1 (escells) PST417-1 (escells) PST1009-1 (escells)
Private Clones OST427609 (lexicon) OST277638 (lexicon) OST231801 (lexicon) OST128521 (lexicon)
OST60615 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000709783 (Chr15:79269202..79269285 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGTTGCGTGTGGGAAATA Chr15:79269256..79269275 60.89 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000709783 (Chr15:79269202..79269285 -)
Downstram Exon
ENSMUSE00000377323 (Chr15:79260485..79260595 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGTTGCGTGTGGGAAATA Chr15:79269256..79269275 60.89 50 CGAGCTTGATGGCTACTTCC Chr15:79260532..79260551 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711145 Chr15:79272358..79272432 No primer for this exon
upstream ENSMUSE00000713441 Chr15:79272358..79272429 No primer for this exon
upstream ENSMUSE00000714596 Chr15:79271651..79272248 TAGCATAGCCTCCCTTTGGA Chr15:79271787..79271806 59.8 50
upstream ENSMUSE00000504943 Chr15:79269202..79269295 GGAGTTGCGTGTGGGAAATA Chr15:79269256..79269275 60.89 50
upstream ENSMUSE00000709783 Chr15:79269202..79269285 GGAGTTGCGTGTGGGAAATA Chr15:79269256..79269275 60.89 50
upstream ENSMUSE00000717915 Chr15:79269202..79269289 GGAGTTGCGTGTGGGAAATA Chr15:79269256..79269275 60.89 50
upstream ENSMUSE00000377323 Chr15:79260485..79260595 CCATCAAGCTCGAATGTGTG Chr15:79260546..79260565 60.26 50

*** Putative Vector Insertion (Chr 15: 79260484 - 79269286) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000557632 Chr15:79260142..79260290 CTGAACTTCCGGGAACAGAA Chr15:79260154..79260173 60.22 50
downstream ENSMUSE00000557630 Chr15:79256689..79256917 GAAGTTGTCGGGCTTCACAT Chr15:79256830..79256849 60.12 50
downstream ENSMUSE00000557627 Chr15:79255930..79256100 TCGCTAATCCGCTCGTACTT Chr15:79255955..79255974 60 50
downstream ENSMUSE00000476709 Chr15:79255270..79255418 CTGGCGCAGGTAGGAGTAGT Chr15:79255320..79255339 59.52 60
downstream ENSMUSE00000647824 Chr15:79254582..79254685 CGCAAGAGCTTCGTTGTCTC Chr15:79254616..79254635 61.26 55
downstream ENSMUSE00000647823 Chr15:79254368..79254485 TATCTTTGAGGGGGCAGTTG Chr15:79254383..79254402 60.07 50
downstream ENSMUSE00000718337 Chr15:79252911..79254485 CTAGTGACTGGGCGAGAAGG Chr15:79253350..79253369 60.01 60
downstream ENSMUSE00000126510 Chr15:79251248..79251440 CGTCTTTCCCGGTCTACATC Chr15:79251378..79251397 59.55 55
downstream ENSMUSE00000126499 Chr15:79251014..79251153 GTGAGATCGCTCTGGGAGAA Chr15:79251105..79251124 60.5 55
downstream ENSMUSE00000377805 Chr15:79250335..79250398 GTGGTCGCTCTCCTCATTTC Chr15:79250331..79250350 59.81 55
downstream ENSMUSE00000712433 Chr15:79249596..79249617 No primer for this exon
downstream ENSMUSE00000480719 Chr15:79248289..79249617 AAAGCCCCATACAACACTGG Chr15:79249130..79249149 59.85 50
downstream ENSMUSE00000716868 Chr15:79248286..79249617 AAAGCCCCATACAACACTGG Chr15:79249130..79249149 59.85 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTTGAAGCATGGAGTTGC Chr15:79266266..79266286 60.26 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTTGAAGCATGGAGTTGC Chr15:79266266..79266286 60.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGTTGCCCTTTTCTCTGTCA Chr15:79266183..79266203 60.23 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGTTGCCCTTTTCTCTGTCA Chr15:79266183..79266203 60.23 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022433