Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14410
Trapped Gene
Cd59a (ENSMUSG00000032679)
Vector Insertion
Chr 2: 103944407 - 103950896
Public Clones FHCRC-GT-S14-6A1 (fhcrc) IST15097D3 (tigm)
Private Clones OST465784 (lexicon) OST373320 (lexicon) OST299006 (lexicon) OST126142 (lexicon)
OST122292 (lexicon) OST122291 (lexicon) OST122232 (lexicon) OST81302 (lexicon)
OST65154 (lexicon) OST50559 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000227061 (Chr2:103944328..103944406 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGAGCTCAGAGGGGACTCA Chr2:103944348..103944367 59.66 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000227061 (Chr2:103944328..103944406 +)
Downstram Exon
ENSMUSE00000227056 (Chr2:103950897..103951001 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGAGCTCAGAGGGGACTCA Chr2:103944348..103944367 59.66 60 ACCGGTTGGAAACAGTGGTA Chr2:103950936..103950955 60.27 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000686771 Chr2:103935994..103936084 CAGTCACTGGCGATCTGAAA Chr2:103936026..103936045 59.98 50
upstream ENSMUSE00000227061 Chr2:103944328..103944406 GAGAGCTCAGAGGGGACTCA Chr2:103944348..103944367 59.66 60

*** Putative Vector Insertion (Chr 2: 103944407 - 103950896) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000227056 Chr2:103950897..103951001 ACCGGTTGGAAACAGTGGTA Chr2:103950936..103950955 60.27 50
downstream ENSMUSE00000227053 Chr2:103954132..103955342 TTTTGAGCGTGTCAGAGTGG Chr2:103954738..103954757 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCCCTGTAGGGAAAGAAC Chr2:103950432..103950452 58.79 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCCCTGTAGGGAAAGAAC Chr2:103950432..103950452 58.79 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032679