Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14418
Trapped Gene
Klf2 (ENSMUSG00000055148)
Vector Insertion
Chr 8: 74844142 - 74844642
Public Clones FHCRC-GT-S13-8D1 (fhcrc) IST10885C7 (tigm)
Private Clones OST441847 (lexicon) OST439456 (lexicon) OST433461 (lexicon) OST356417 (lexicon)
OST346612 (lexicon) OST312270 (lexicon) OST297584 (lexicon) OST263001 (lexicon)
OST262412 (lexicon) OST195526 (lexicon) OST182461 (lexicon) OST170099 (lexicon)
OST148637 (lexicon) OST128912 (lexicon) OST125192 (lexicon) OST67970 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000424021 (Chr8:74843325..74844141 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCAAGAGCTCGCACCTAAA Chr8:74844099..74844118 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000424021 (Chr8:74843325..74844141 +)
Downstram Exon
ENSMUSE00000581769 (Chr8:74844643..74845553 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCAAGAGCTCGCACCTAAA Chr8:74844099..74844118 60.01 50 ACTTGTCCGGCTCTGTCCTA Chr8:74844934..74844953 59.87 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000213133 Chr8:74842961..74843048 GAGCCTATCTTGCCGTCCTT Chr8:74842989..74843008 60.73 55
upstream ENSMUSE00000424021 Chr8:74843325..74844141 ACCAAGAGCTCGCACCTAAA Chr8:74844099..74844118 60.01 50

*** Putative Vector Insertion (Chr 8: 74844142 - 74844642) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000581769 Chr8:74844643..74845553 ACTTGTCCGGCTCTGTCCTA Chr8:74844934..74844953 59.87 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACACCAAGAGCTCGCACCTA Chr8:74844098..74844118 61 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACACCAAGAGCTCGCACCTA Chr8:74844098..74844118 61 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055148