Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14420
Trapped Gene
Gtrgeo22 (ENSMUSG00000020308)
Vector Insertion
Chr 10: 79132529 - 79138144
Public Clones (sanger) (sanger) (sanger) E028F02 (ggtc) P115F01 (ggtc) D146E09 (ggtc)
(ggtc) E139A09 (ggtc) D106D04 (ggtc) (ggtc) D184D10 (ggtc) 5SE305H12 (ggtc)
E139H05 (ggtc) D146E09 (ggtc) (ggtc) E130A06 (ggtc) D008H08 (ggtc)
(ggtc) P138D11 (ggtc) D184C10 (ggtc) (ggtc) E139C02 (ggtc) D130A06 (ggtc)
(ggtc) FHCRC-GT-S10-2G1 (fhcrc) FHCRC-GT-ROSA22 (fhcrc) FHCRC-GT-S13-7H1 (fhcrc)
IST14251E5 (tigm) IST14628B3 (tigm) IST11729F9 (tigm) IST14394B11 (tigm)
IST14312D11 (tigm) IST14054A9 (tigm) IST14584F8 (tigm) IST12417E12 (tigm)
IST14168B6 (tigm)
Private Clones OST471317 (lexicon) OST469299 (lexicon) OST463989 (lexicon) OST462179 (lexicon)
OST461741 (lexicon) OST457233 (lexicon) OST444817 (lexicon) OST440693 (lexicon)
OST436895 (lexicon) OST436518 (lexicon) OST433248 (lexicon) OST431912 (lexicon)
OST431708 (lexicon) OST419761 (lexicon) OST413080 (lexicon) OST405345 (lexicon)
OST405002 (lexicon) OST397351 (lexicon) OST382387 (lexicon) OST379211 (lexicon)
OST377545 (lexicon) OST373398 (lexicon) OST344655 (lexicon) OST335356 (lexicon)
OST329821 (lexicon) OST323261 (lexicon) OST301832 (lexicon) OST297460 (lexicon)
OST291280 (lexicon) OST287131 (lexicon) OST284697 (lexicon) OST284058 (lexicon)
OST283643 (lexicon) OST282001 (lexicon) OST279656 (lexicon) OST277069 (lexicon)
OST276038 (lexicon) OST272817 (lexicon) OST269468 (lexicon) OST268900 (lexicon)
OST268876 (lexicon) OST267262 (lexicon) OST263032 (lexicon) OST258375 (lexicon)
OST253227 (lexicon) OST253099 (lexicon) OST251445 (lexicon) OST250696 (lexicon)
OST250617 (lexicon) OST239922 (lexicon) OST234734 (lexicon) OST214819 (lexicon)
OST214745 (lexicon) OST208676 (lexicon) OST207084 (lexicon) OST206487 (lexicon)
OST205511 (lexicon) OST202914 (lexicon) OST202894 (lexicon) OST202377 (lexicon)
OST202226 (lexicon) OST198099 (lexicon) OST189695 (lexicon) OST182624 (lexicon)
OST180523 (lexicon) OST176783 (lexicon) OST176319 (lexicon) OST174144 (lexicon)
OST165579 (lexicon) OST153495 (lexicon) OST146366 (lexicon) OST145217 (lexicon)
OST140653 (lexicon) OST138808 (lexicon) OST138712 (lexicon) OST137461 (lexicon)
OST130898 (lexicon) OST110716 (lexicon) OST104941 (lexicon) OST99875 (lexicon)
OST90123 (lexicon) OST83235 (lexicon) OST81377 (lexicon) OST79933 (lexicon)
OST79597 (lexicon) OST69061 (lexicon) OST66273 (lexicon) OST57840 (lexicon)
OST54081 (lexicon) OST50697 (lexicon) OST48258 (lexicon) OST29707 (lexicon)
OST6205 (lexicon)
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000405032 (Chr10:79132155..79132528 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000405032 (Chr10:79132155..79132528 +)
Downstram Exon
ENSMUSE00000103234 (Chr10:79138145..79138871 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000405032 Chr10:79132155..79132528 No primer for this exon

*** Putative Vector Insertion (Chr 10: 79132529 - 79138144) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000103234 Chr10:79138145..79138871 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr10:79132579..79132599 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGACGTGACTGGGAAAACC Chr10:79132576..79132596 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020308