Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14426
Trapped Gene
Pcf11 (ENSMUSG00000041328)
Vector Insertion
Chr 7: 99814249 - 99818145
Public Clones FHCRC-GT-S13-2G1 (fhcrc)
Private Clones OST456677 (lexicon) OST267717 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672332 (Chr7:99817731..99818144 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCAATAGCAAACCGCACA Chr7:99818022..99818041 59.87 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672332 (Chr7:99817731..99818144 -)
Downstram Exon
ENSMUSE00000529636 (Chr7:99814250..99814375 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCAATAGCAAACCGCACA Chr7:99818022..99818041 59.87 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672333 Chr7:99818368..99818413 No primer for this exon
upstream ENSMUSE00000422327 Chr7:99817939..99818394 CTTCAATAGCAAACCGCACA Chr7:99818022..99818041 59.87 45
upstream ENSMUSE00000716708 Chr7:99817939..99818443 CTTCAATAGCAAACCGCACA Chr7:99818022..99818041 59.87 45
upstream ENSMUSE00000672332 Chr7:99817731..99818144 CTTCAATAGCAAACCGCACA Chr7:99818022..99818041 59.87 45
upstream ENSMUSE00000529636 Chr7:99814250..99814375 No primer for this exon

*** Putative Vector Insertion (Chr 7: 99814249 - 99818145) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000529634 Chr7:99812477..99812665 TCATCCCATGTGGAACGTAA Chr7:99812591..99812610 59.77 45
downstream ENSMUSE00000469193 Chr7:99811972..99812166 GATACTGGGGGAACTGACCA Chr7:99812097..99812116 59.78 55
downstream ENSMUSE00000471458 Chr7:99809469..99810586 CTTTGGGTCACCACCTGACT Chr7:99809518..99809537 60 55
downstream ENSMUSE00000517796 Chr7:99808510..99808690 ACTTAGTCGGTGCTGCTGCT Chr7:99808554..99808573 60.22 55
downstream ENSMUSE00000513948 Chr7:99808308..99808398 AGCTGTCGAATTTGATGCAC Chr7:99808303..99808322 58.88 45
downstream ENSMUSE00000359398 Chr7:99805818..99807376 CCACGATGTCCTTCAAACCT Chr7:99806799..99806818 59.97 50
downstream ENSMUSE00000201528 Chr7:99801660..99801759 AACGCTACTGGCTGAGCAAC Chr7:99801706..99801725 60.6 55
downstream ENSMUSE00000201526 Chr7:99797966..99798085 GCTGAATCAGGCTGTGACAA Chr7:99797952..99797971 59.99 50
downstream ENSMUSE00000201514 Chr7:99797436..99797541 CTGATCCTCGTCCTCCTCAG Chr7:99797470..99797489 59.94 60
downstream ENSMUSE00000201518 Chr7:99796452..99796635 GTCTGGGATGTCGTGAACCT Chr7:99796533..99796552 59.97 55
downstream ENSMUSE00000201520 Chr7:99795438..99795593 ACTGGCTTTTTGCACGTTCT Chr7:99795517..99795536 59.92 45
downstream ENSMUSE00000201527 Chr7:99794940..99795032 GTGCCATTCTTCCTCCTCTTC Chr7:99794948..99794968 60.21 52.38
downstream ENSMUSE00000201529 Chr7:99794500..99794535 No primer for this exon
downstream ENSMUSE00000590731 Chr7:99792765..99793287 CAGGGTTCTTGCAATTCGTT Chr7:99793165..99793184 60.11 45
downstream ENSMUSE00000718326 Chr7:99792222..99793287 CAGGGTTCTTGCAATTCGTT Chr7:99793165..99793184 60.11 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACACTGGCTCAGCACAAAT Chr7:99815093..99815113 59.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAAGGGCTGCTACCTTTA Chr7:99815123..99815143 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTCCGCTTACCAACTCCCTA Chr7:99814711..99814731 59.7 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCCGCTTACCAACTCCCTATT Chr7:99814709..99814730 59.97 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041328