Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14434
Trapped Gene
Phf21a (ENSMUSG00000058318)
Vector Insertion
Chr 2: 92026767 - 92054205
Public Clones (sanger) (sanger) 5SD057H01 (ggtc) 3SD057H01 (ggtc) FHCRC-GT-S13-12F1 (fhcrc)
IST12174H7BBR1 (tigm) IST14833C7 (tigm) IST14391A9 (tigm) IST10131H6 (tigm)
IST12174H7 (tigm) IST14672E2 (tigm) IST14582C4 (tigm) IST14279B7 (tigm)
IST14833D3 (tigm) IST14960F7 (tigm) IST13215F4 (tigm) IST14411A1 (tigm)
IST14951G3 (tigm) IST12726H2 (tigm) IST13215B9 (tigm) IST13224H12 (tigm)
IST14451G4 (tigm) IST12061C11 (tigm) IST13213F11 (tigm) IST12726H2 (tigm)
IST13529C10 (tigm) IST11134A6 (tigm) IST13215C5 (tigm) IST14875B11 (tigm)
IST14672C5 (tigm) IST13102A11 (tigm) IST14883F11 (tigm) IST13241A3 (tigm)
IST14596F2 (tigm) IST12849A7 (tigm) IST14960C7 (tigm) IST12159A5 (tigm)
IST12155C6 (tigm) IST12061C11 (tigm) IST10026D12 (tigm) IST12818B9 (tigm)
IST12850C5 (tigm) IST13234G8 (tigm) IST13256B3 (tigm) IST13200G6 (tigm)
IST12164A2 (tigm) IST13547G6 (tigm) IST13213C8 (tigm) IST13217C1 (tigm)
IST12159H5 (tigm) IST14951B2 (tigm) IST13545D6 (tigm) IST13253A11 (tigm)
IST13105D7 (tigm) IST11528G7 (tigm) IST13612H2 (tigm) IST13220A12 (tigm)
Private Clones OST430246 (lexicon) OST341405 (lexicon) OST220228 (lexicon) OST35349 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000687363 (Chr2:92026708..92026766 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000687363 (Chr2:92026708..92026766 +)
Downstram Exon
ENSMUSE00000687372 (Chr2:92054206..92054246 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTCCTTCAGCTCTCCAGTCC Chr2:92054229..92054248 59.13 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000687386 Chr2:91933274..91933310 AAAAACTGAGCCCACTACCTCA Chr2:91933287..91933308 60.17 45.46
upstream ENSMUSE00000642532 Chr2:92024263..92024509 CCCTCCCCATGAAGAAGAGT Chr2:92024406..92024425 60.45 55
upstream ENSMUSE00000687368 Chr2:92024364..92024509 CCCTCCCCATGAAGAAGAGT Chr2:92024406..92024425 60.45 55
upstream ENSMUSE00000687365 Chr2:92024433..92024509 CTCAGAGTTCCTGCCTCCAG Chr2:92024456..92024475 60.13 60
upstream ENSMUSE00000687364 Chr2:92025640..92025745 TCTCTCTTCGCTCGCTCTCT Chr2:92025682..92025701 59.73 55
upstream ENSMUSE00000687363 Chr2:92026708..92026766 No primer for this exon

*** Putative Vector Insertion (Chr 2: 92026767 - 92054205) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000687372 Chr2:92054206..92054246 CTCCTTCAGCTCTCCAGTCC Chr2:92054229..92054248 59.13 60
downstream ENSMUSE00000687367 Chr2:92055621..92055732 TCCCCATCTTGGAGATTCAC Chr2:92055678..92055697 59.86 50
downstream ENSMUSE00000710902 Chr2:92061627..92061772 GCCTTCTCCACGCTCTCTTA Chr2:92061716..92061735 59.72 55
downstream ENSMUSE00000715490 Chr2:92061627..92061772 GCCTTCTCCACGCTCTCTTA Chr2:92061716..92061735 59.72 55
downstream ENSMUSE00000687371 Chr2:92061629..92061772 GCCTTCTCCACGCTCTCTTA Chr2:92061716..92061735 59.72 55
downstream ENSMUSE00000599875 Chr2:92068606..92068638 TTCATTTGGGCAACCAGTTT Chr2:92068628..92068647 60.34 40
downstream ENSMUSE00000710004 Chr2:92068606..92068638 TTCATTTGGGCAACCAGTTT Chr2:92068628..92068647 60.34 40
downstream ENSMUSE00000717571 Chr2:92068606..92068638 TTCATTTGGGCAACCAGTTT Chr2:92068628..92068647 60.34 40
downstream ENSMUSE00000599874 Chr2:92070816..92070881 TGATTTTGGCTTGGAGTTCA Chr2:92070864..92070883 59.25 40
downstream ENSMUSE00000687353 Chr2:92070816..92070881 TGATTTTGGCTTGGAGTTCA Chr2:92070864..92070883 59.25 40
downstream ENSMUSE00000599873 Chr2:92160386..92160616 TTAGACTAGGCGGTGCTGCT Chr2:92160608..92160627 60.18 55
downstream ENSMUSE00000687352 Chr2:92160386..92160616 TTAGACTAGGCGGTGCTGCT Chr2:92160608..92160627 60.18 55
downstream ENSMUSE00000565030 Chr2:92167070..92167321 CCACAATTTGGACAGCCTCT Chr2:92167304..92167323 60.11 50
downstream ENSMUSE00000687358 Chr2:92167073..92167321 ACAATTTGGACAGCCTCTGC Chr2:92167302..92167321 60.26 50
downstream ENSMUSE00000299255 Chr2:92168469..92168558 GAGGAGGTGTTGCTTGAACC Chr2:92168493..92168512 59.7 55
downstream ENSMUSE00000447288 Chr2:92168472..92168558 GGCGTGGAGTGAGTCTAGGA Chr2:92168544..92168563 60.41 60
downstream ENSMUSE00000687351 Chr2:92168472..92168558 GGCGTGGAGTGAGTCTAGGA Chr2:92168544..92168563 60.41 60
downstream ENSMUSE00000599867 Chr2:92170672..92170965 AACGTTTTGGCTATGGTTGC Chr2:92170868..92170887 60 45
downstream ENSMUSE00000599872 Chr2:92170672..92170965 AACGTTTTGGCTATGGTTGC Chr2:92170868..92170887 60 45
downstream ENSMUSE00000299242 Chr2:92184701..92184799 TAACGGTACGGCTCTCTGCT Chr2:92184758..92184777 60.04 55
downstream ENSMUSE00000564996 Chr2:92184701..92184739 CTGCTTCTGGGTGGGATTTA Chr2:92184728..92184747 60.07 50
downstream ENSMUSE00000565025 Chr2:92184705..92184741 CTGCTTCTGGGTGGGATTTA Chr2:92184728..92184747 60.07 50
downstream ENSMUSE00000299234 Chr2:92188153..92188204 CCAACCCTAGAGACACCATGA Chr2:92188185..92188205 59.97 52.38
downstream ENSMUSE00000643195 Chr2:92188178..92188204 No primer for this exon
downstream ENSMUSE00000299225 Chr2:92189035..92189114 AGACAGCCCCACTGTACACC Chr2:92189106..92189125 60.03 60
downstream ENSMUSE00000299219 Chr2:92189545..92189605 No primer for this exon
downstream ENSMUSE00000299209 Chr2:92191766..92191788 CTTTGGCCAGTGTTCCTCAT Chr2:92191791..92191810 60.11 50
downstream ENSMUSE00000447225 Chr2:92191858..92192021 CAGGTGCAGGGAAAGTGAAT Chr2:92191986..92192005 60.11 50
downstream ENSMUSE00000687356 Chr2:92191989..92192021 No primer for this exon
downstream ENSMUSE00000299203 Chr2:92197021..92197176 CACGTGTCACACATCAGCAA Chr2:92197091..92197110 60.37 50
downstream ENSMUSE00000299198 Chr2:92198851..92198926 TGCTTTGTAGGCGATGTAGG Chr2:92198928..92198947 58.94 50
downstream ENSMUSE00000299191 Chr2:92199263..92199366 TTGTTCCCGCTCCTGTTTTA Chr2:92199330..92199349 60.61 45
downstream ENSMUSE00000643191 Chr2:92200326..92201050 AAACGGCTCCCAGTAAGGAT Chr2:92200981..92201000 59.96 50
downstream ENSMUSE00000687362 Chr2:92200326..92201058 AAACGGCTCCCAGTAAGGAT Chr2:92200981..92201000 59.96 50
downstream ENSMUSE00000687366 Chr2:92200326..92204822 CTTGAAGGACGTCATCAGCA Chr2:92203836..92203855 59.98 50
downstream ENSMUSE00000687369 Chr2:92200326..92201986 AAACGGCTCCCAGTAAGGAT Chr2:92200981..92201000 59.96 50
downstream ENSMUSE00000564995 Chr2:92200951..92201046 AAACGGCTCCCAGTAAGGAT Chr2:92200981..92201000 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr2:92035817..92035837 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCCAACAGGTATTTCGTG Chr2:92053802..92053822 61.85 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058318