Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1445
Trapped Gene
Bnc2 (ENSMUSG00000028487)
Vector Insertion
Chr 4: 84201809 - 84320878
Public Clones CG0371 (sanger) AB0082 (sanger) (sanger) 5SE026B10 (ggtc) 3SD075F06 (ggtc)
5SD162D03 (ggtc) 3SE062G03 (ggtc) (cmhd) (egtc) Ayu21-18 (egtc)
(egtc) IST14384G11 (tigm) IST11197D6 (tigm) IST14406B3 (tigm) IST10741D10 (tigm)
IST13095G1 (tigm) IST10350G7 (tigm) IST10363G7 (tigm) IST14557A8 (tigm)
IST10337E3 (tigm) IST12831D8 (tigm) IST12285A2 (tigm) IST10053F8 (tigm)
IST14812H11 (tigm) IST10363H7 (tigm) IST11413A6 (tigm) IST11413A6 (tigm)
IST12761B10 (tigm) IST12285A2 (tigm) IST13032B12 (tigm) IST10363H8 (tigm)
IST14626D11 (tigm) IST12050H5 (tigm) IST10131G11 (tigm)
Private Clones OST320518 (lexicon) OST178785 (lexicon) OST170161 (lexicon) OST67977 (lexicon)
OST32175 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672378 (Chr4:84320879..84320990 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGCTAAGAGGAGACCAAGA Chr4:84320916..84320935 59.57 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672378 (Chr4:84320879..84320990 -)
Downstram Exon
ENSMUSE00000632105 (Chr4:84201683..84201808 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGCTAAGAGGAGACCAAGA Chr4:84320916..84320935 59.57 55 GAGATGGATCAACCCCACAG Chr4:84201669..84201688 60.33 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672378 Chr4:84320879..84320990 CCGCTAAGAGGAGACCAAGA Chr4:84320916..84320935 59.57 55

*** Putative Vector Insertion (Chr 4: 84201809 - 84320878) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000632105 Chr4:84201683..84201808 GAGATGGATCAACCCCACAG Chr4:84201669..84201688 60.33 55
downstream ENSMUSE00000443683 Chr4:84192109..84192309 GTTCTGGTTCCGAACTGCAT Chr4:84192163..84192182 60.12 50
downstream ENSMUSE00000662706 Chr4:84192109..84192237 GTTCTGGTTCCGAACTGCAT Chr4:84192163..84192182 60.12 50
downstream ENSMUSE00000468368 Chr4:84152432..84152515 AAGTCTGCACCCAGCACTCT Chr4:84152453..84152472 60.06 55
downstream ENSMUSE00000603220 Chr4:84060150..84060252 CACACGTGCAGTTTACCAATG Chr4:84060197..84060217 60.08 47.62
downstream ENSMUSE00000469416 Chr4:84036793..84037028 ATGTCAAACACCACGTTGGA Chr4:84036928..84036947 59.85 45
downstream ENSMUSE00000179656 Chr4:83937597..83939566 CCATGTTGCAACCTTCAATG Chr4:83938779..83938798 59.96 45
downstream ENSMUSE00000518854 Chr4:83920999..83922351 ATTTGGAGTGTCCGTTCTGG Chr4:83921647..83921666 59.97 50
downstream ENSMUSE00000672376 Chr4:83920748..83922351 ATTTGGAGTGTCCGTTCTGG Chr4:83921647..83921666 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCAGTGTGGAGAGAAGACTG Chr4:84266835..84266856 59.19 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTTCGTGACTGGGAAAACC Chr4:84266811..84266832 61.39 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTGTAATCGCCTTGCAGCAC Chr4:84266923..84266943 61.78 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTCACGTGACTGGGAAAACC Chr4:84266924..84266944 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028487