Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14454
Trapped Gene
Spred1 (ENSMUSG00000027351)
Vector Insertion
Chr 2: 116978903 - 116989233
Public Clones FHCRC-GT-S12-12C1 (fhcrc)
Private Clones not available
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000168672 (Chr2:116978728..116978902 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAGCAGCGTCACTGTCTTC Chr2:116978811..116978830 60.34 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000168672 (Chr2:116978728..116978902 +)
Downstram Exon
ENSMUSE00000168674 (Chr2:116989234..116989402 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAGCAGCGTCACTGTCTTC Chr2:116978811..116978830 60.34 55 TCATCGATCTTCCAGTGGTG Chr2:116989316..116989335 59.63 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000642403 Chr2:116946845..116947492 ATCACGGTGAGGGAAAGATG Chr2:116947444..116947463 59.93 50
upstream ENSMUSE00000685840 Chr2:116947374..116947492 ATCACGGTGAGGGAAAGATG Chr2:116947444..116947463 59.93 50
upstream ENSMUSE00000168672 Chr2:116978728..116978902 TGAGCAGCGTCACTGTCTTC Chr2:116978811..116978830 60.34 55

*** Putative Vector Insertion (Chr 2: 116978903 - 116989233) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000168674 Chr2:116989234..116989402 TCATCGATCTTCCAGTGGTG Chr2:116989316..116989335 59.63 50
downstream ENSMUSE00000168678 Chr2:116990682..116990731 TTCAGCCTCAGTTTTTGACG Chr2:116990713..116990732 59.05 45
downstream ENSMUSE00000295550 Chr2:116997664..116997822 GGGAACGGGAAGTGTCTTCT Chr2:116997694..116997713 60.49 55
downstream ENSMUSE00000685839 Chr2:116997664..116998590 TCACTAGGGAACGGGAAGTG Chr2:116997700..116997719 60.1 55
downstream ENSMUSE00000295540 Chr2:117001080..117001181 TGCCGCTGTACATATTCCAT Chr2:117001144..117001163 59.02 45
downstream ENSMUSE00000295535 Chr2:117003038..117006017 AGAACGTTCCCCATCCTCTT Chr2:117003352..117003371 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTTTGCTAACCAGCCACA Chr2:116987913..116987933 59.46 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTTTGCTAACCAGCCACA Chr2:116987913..116987933 59.46 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027351