Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14455
Trapped Gene
Cks2 (ENSMUSG00000062248)
Vector Insertion
Chr 13: 51745082 - 51745705
Public Clones FHCRC-GT-S17-5F1 (fhcrc) FHCRC-GT-S12-12A1 (fhcrc)
Private Clones OST118742 (lexicon) OST79406 (lexicon) OST65661 (lexicon) OST48984 (lexicon)
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000493444 (Chr13:51744954..51745081 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATGTCCGAAGAGGAGTGGA Chr13:51745005..51745024 60.2 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000493444 (Chr13:51744954..51745081 +)
Downstram Exon
ENSMUSE00000682509 (Chr13:51745706..51746023 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATGTCCGAAGAGGAGTGGA Chr13:51745005..51745024 60.2 55 GATCCCAGCTGCACTTCATT Chr13:51745776..51745795 60.23 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682511 Chr13:51740694..51740840 TGATCCCGCTTACTCCTCTG Chr13:51740750..51740769 60.35 55
upstream ENSMUSE00000493444 Chr13:51744954..51745081 GATGTCCGAAGAGGAGTGGA Chr13:51745005..51745024 60.2 55

*** Putative Vector Insertion (Chr 13: 51745082 - 51745705) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000682509 Chr13:51745706..51746023 GATCCCAGCTGCACTTCATT Chr13:51745776..51745795 60.23 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATTCATGAGCCAGGTAAGC Chr13:51745068..51745089 60.23 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTACCTGCAAAAGCGTGAC Chr13:51745119..51745139 59.08 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062248