Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14461
Trapped Gene
Tmem2 (ENSMUSG00000024754)
Vector Insertion
Chr 19: 21854743 - 21867127
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
E066E08 (ggtc) D111E08 (ggtc) 3SE223G07 (ggtc) E051G08 (ggtc) D104G03 (ggtc)
E021C12 (ggtc) E066E08 (ggtc) D109G09 (ggtc) (ggtc) E036H05 (ggtc)
E091F03 (ggtc) D170A04 (ggtc) 5SE223G07 (ggtc) E051G08 (ggtc) D106F03 (ggtc)
(ggtc) E021C12 (ggtc) FHCRC-GT-S11-9E1 (fhcrc) PST4792-NR (escells)
IST14249E1 (tigm) IST14468F6 (tigm) IST14507B2 (tigm)
Private Clones OST321414 (lexicon) OST280676 (lexicon) OST237240 (lexicon) OST225530 (lexicon)
OST195197 (lexicon) OST32702 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000620765 (Chr19:21854661..21854742 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGAACTCTGAGCCGTCACC Chr19:21854682..21854701 59.99 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000620765 (Chr19:21854661..21854742 +)
Downstram Exon
ENSMUSE00000642465 (Chr19:21867128..21867470 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGAACTCTGAGCCGTCACC Chr19:21854682..21854701 59.99 60 GGACGTAAGGGAACCACCTT Chr19:21867252..21867271 60.22 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000546673 Chr19:21852832..21853276 GCTGATTAGAGGGACCCTAGC Chr19:21852870..21852890 59.34 57.14
upstream ENSMUSE00000620765 Chr19:21854661..21854742 GAGAACTCTGAGCCGTCACC Chr19:21854682..21854701 59.99 60

*** Putative Vector Insertion (Chr 19: 21854743 - 21867127) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000642465 Chr19:21867128..21867470 GGACGTAAGGGAACCACCTT Chr19:21867252..21867271 60.22 55
downstream ENSMUSE00000642464 Chr19:21871817..21871957 TTCCTGAGACGAGGGTTTTG Chr19:21871853..21871872 60.22 50
downstream ENSMUSE00000642463 Chr19:21872357..21872918 ATCCCCAAACACAAGCAGTC Chr19:21872379..21872398 59.97 50
downstream ENSMUSE00000642462 Chr19:21876352..21876521 CACCATCGATGACACCAACT Chr19:21876389..21876408 59.39 50
downstream ENSMUSE00000642461 Chr19:21881849..21882037 CACAATTCGGTCTCCAGCTT Chr19:21881949..21881968 60.26 50
downstream ENSMUSE00000252348 Chr19:21883759..21883928 AATGTTGCGGGTGAGAAGTC Chr19:21883844..21883863 60.12 50
downstream ENSMUSE00000252328 Chr19:21886257..21886466 GATGAACAGACAGGCCATCC Chr19:21886422..21886441 60.48 55
downstream ENSMUSE00000353366 Chr19:21886701..21886906 AGTGTGTCGAAGCCAATGGT Chr19:21886732..21886751 60.58 50
downstream ENSMUSE00000252251 Chr19:21887041..21887110 CAGCTGCGTTATTGATCAGG Chr19:21887102..21887121 59.44 50
downstream ENSMUSE00000252233 Chr19:21889921..21890049 ACTGGACTCCCCAGTTGGTT Chr19:21889974..21889993 60.8 55
downstream ENSMUSE00000252215 Chr19:21892413..21892501 TGGTCGTTTTGACACCTTTG Chr19:21892452..21892471 59.58 45
downstream ENSMUSE00000252195 Chr19:21898278..21898409 CAATGAGCCTGTCGATGATG Chr19:21898348..21898367 60.22 50
downstream ENSMUSE00000252178 Chr19:21899580..21899615 GTCAGCCCCTTTCCGTTATC Chr19:21899609..21899628 60.83 55
downstream ENSMUSE00000252158 Chr19:21900530..21900685 TCCTGACTGGACCCTTCATC Chr19:21900571..21900590 60.05 55
downstream ENSMUSE00000252137 Chr19:21904290..21904467 AGGCCCATCGTAAATCTGAA Chr19:21904332..21904351 59.53 45
downstream ENSMUSE00000252113 Chr19:21906517..21906732 GAGTTCTTATCGCCGTCCAG Chr19:21906593..21906612 59.84 55
downstream ENSMUSE00000252086 Chr19:21909908..21910116 CAACAGGCTGGTACTGTGGA Chr19:21910037..21910056 59.74 55
downstream ENSMUSE00000144752 Chr19:21916531..21916713 AACCTGAAAGCTCGTGTTGG Chr19:21916588..21916607 60.29 50
downstream ENSMUSE00000144754 Chr19:21919110..21919329 AATACTGCGGGTACGCTTTG Chr19:21919258..21919277 60.15 50
downstream ENSMUSE00000144757 Chr19:21922427..21922525 TCCTCGCTGAATTTCTGCTT Chr19:21922510..21922529 60.1 45
downstream ENSMUSE00000144755 Chr19:21926715..21926869 GAACATCCGCTTTTCCTTCA Chr19:21926816..21926835 60.19 45
downstream ENSMUSE00000144758 Chr19:21930149..21930252 GCCAGTCCCAGAACTGCTAA Chr19:21930229..21930248 60.4 55
downstream ENSMUSE00000546624 Chr19:21930645..21932817 CGCTCTGCGTTTTAAAGGTC Chr19:21931587..21931606 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCAGCCTGTGGATGAGAG Chr19:21860710..21860730 59.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAGCGTGACTGGGAAAACC Chr19:21860790..21860810 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024754